1. Calculate the size of the resulting fragments as they will occur after digestion and write the sizes on the maps below. Note that linear DNA has a total size of 48 502 bp (see figure 3A).
Q: Fumerase is an enzyme in the citric acid cycle that catalyzes the conversion of fumerate to…
A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…
Q: For the following scenarios, determine whether the molecules in the scenario are moving by simple…
A: Biological membranes are structures that surround the cell or organelles and act as barriers. An…
Q: Which of the following laws of matter best describes the statements on sulfide minerals? Select one:…
A: INTRODUCTION : Sulfide minerals - They are a class of minerals consisting of sulfide or disulfide…
Q: 385 What acts as a reductant in the glutamate synthase reaction to catalyze the transfer of the…
A: Reductant is a substance that donates electrons to another substance and reduce it. In an…
Q: Which of the different carbohydrate tests would give a positive result for maltose? Describe the…
A: Maltose is a disaccharide composed of 2 D-glucose molecules. The bonding pattern is α-1,4 . Hence…
Q: True or False for each question ( ) Guanine, Adenine, Uracil, and Cytosine are commonly found…
A: The biological macromolecules are classified as nucleic acids, proteins, lipids and carbohydrates.…
Q: What are the essential amino acids and how does the body get them? Give an example of one of them…
A: DISCLAIMER FOR MULTIPART Since you have posted a question with multiple sub-parts, we will solve…
Q: Biochemical events in the synthesis of ATP: I. Subunits of ATP synthase chages in conformation and…
A: ATP synthase is a complex enzyme consists of an F0 and F1 components. It uses the proton motive…
Q: INFLUENCE OF FREE ACID tt #1 tt #2 tt #3 tt #4 CONDITION 4 mL 0.2% HCI + 1 mL starch paste + 1 drop…
A: Effect of saliva on starch: Saliva contains the digesting enzyme amylase, which breaks down starch.…
Q: Which of the following is CORRECT? A) Pyruvate kinase requires Mg2+ for maximal activity. B) A small…
A: Pyruvate Kinase is an enzyme which catalyzes the last step of glycolysis, i.e, conversion of…
Q: write the mechanism for the reaction of CO2 and the amino terminal of the alpha-1 chain of…
A: Hemoglobin is a multimeric protein that transports oxygen and CO2 in the body. A hemoglobin molecule…
Q: What effect is seen on a Lineweaver-Burke graph when a competitive inhibitor is added to an…
A: Competitive inhibition is an enzyme inhibition process where an inhibitor molecule (similar to the…
Q: RNA polymerase is found in the mitochondrial matrix. True False
A: The "powerhouses" of the cell are frequently referred to as mitochondria. They assist in converting…
Q: In the peptide, SWEETLY, bond via its side chain. can still form a standard peptide bond while can…
A: A standard peptide bond is formed as a result of a dehydration ( also called condensation ) reaction…
Q: Η Η Η Η Η ΤΙΤΙΤ H-C-C-C-CC-G | | | | | Η Η Η Η Η I ОН
A: A functional groups are is a group of atoms that bonds within a molecule and is responsible for the…
Q: TABLE 3-1 Properties and Conventions Associated with the Amino Acids pk, values Amino acid…
A: pI refers to the isoelectric point or the pH at which the amino acid carries a positive charge and a…
Q: Describe the p-nitrophenol assay and how a standard curve can be used to calculate the concentration…
A: An assay is a biochemical lab procedure to determine the quantity of molecules of interest in a…
Q: The condensation reaction catalyzed by ß-ketoacyl-ACP synthase synthesizes a four-carbon unit by…
A: Malonyl CoA is formed from carboxylation of Acetyl CoA through an ATP consuming process by biotin…
Q: Select the chemical consequences that could contribute to DNA instability at AP sites. fewer…
A: AP sites are apuraniya sites that are created through the hydrolysis of N glycosyl bond between…
Q: How to calculate percentages of arginine have positively charge at PH=7
A: pH is the measure of H+ ion concentration ( denoted by [H+]) in the solution. High pH means low H+…
Q: Question 15 of 25 Which of the following is true for the acid-base properties of amino acids? Select…
A: The proteins are made of 20 naturally occurring amino acids. The net charge on the side chain of the…
Q: Describe two different ways in which glucose oxidase is regulated. These mechanisms of regulation do…
A: Glucose oxidase: It is an oxidoreductase that catalyzes the conversion of glucose to hydrogen…
Q: How does mottling on tablets appear during drying process? Give your insights on how mottling can be…
A: Introduction During tablet processing different types of defect may arise. An tablet should be free…
Q: 4) For the structure shown on the figure - qualitatively draw Ramachandran plot. Assume a mixture of…
A: Ramachandran plot is a 2-dimensional plot describing the allowed rotation in a protein. A protein…
Q: Enzyme X exhibits maximum activity at pH = 6.3. X shows a fairly sharp decrease in its activity when…
A: Most enzymes are proteins and proteins are primarily made up of amino acids. Amino acids bond with…
Q: State what each of the following symbols stands for, be specific. 4. M 5. SD 6. α
A: Introduction There are various symbols are used in science. Scientific writing requires various…
Q: Question 7 In the human body, under oxygen rich and oxygen poor conditions, respectively, pyruvate…
A: Respiration at molecular level refers to the process through which cells catabolize biomolecules…
Q: Beer's Law to determine Protein Concentration You have purified a recombinant form of the p53…
A: The determination of protein concentration is necessary for diverse biochemical experiments. The…
Q: The production of amino acids from proteins is an example of: a. a non-enzymatic reaction b.…
A: Proteins are large molecular weight polymers of amino acids with diverse biological functions. Many…
Q: vo (μM/min) 25 20 15 10 5 0 7 VO (μM/min) VS pH 8 pH 9.5 10.4
A: Enzymes are the catalysts that function to increase the rate of reaction by decreasing their…
Q: Which of the following are characteristics of animal cells? Select the correct response(s): Their…
A: Centrioles are cylindrical organelles in animal cell. 2 centrioles combine perpendicularly to form a…
Q: 1a Briefly describe or explain what the term "supercoiling" means in the context of DNA structure.…
A: Supercoiling means the coiling of the coil. Cellular DNA is extremely compacted and implies a high…
Q: What is the total yield of NADH, FADH2, and acetyl-CoA from the complete oxidation of myristate?…
A: Myristic acid is a fatty acid with 14 carbon atoms. Beta-oxidation is the oxidation of fatty acid on…
Q: 1. What two enzymes in glycolysis are regulated by high ATP concentrations?
A: INTRODUCTION : Glycolysis : It is a metabolic pathway in which glucose is breaken down into pyruvate…
Q: What is ATP? in 5 sentences Why is ATP important in the body? in 5-7 sentences
A: There are many forms of energy. But living system needs one form of energy i.e., chemical energy.…
Q: Question 24 of 25 Given the following reaction below, what amino acid is involved and what is the…
A:
Q: What are the roles of the other enzymes involved in replication and why they're necessary ?
A: Before cells divide, DNA replication must occur. DNA replication is the complete, faithful copying…
Q: Which of the following statements about oxidative phosphorylation is correct? OH* ions are…
A: Introduction ATP is synthesised in the mitochondria of a cell by a process called oxidative…
Q: Discuss the role (direct or indirect) of carbohydrates on cancer and Suggest an appropriate…
A: Carbohydrates, lipids, and proteins are the biomolecules that are required in large amounts by the…
Q: d) Cleavage by trypsin followed by gel-filtration chromatography gives the expected 6 products,…
A: Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…
Q: Energy balance of the tricarboxylic acid cycle.
A: Tricarboxylic acid is also called as Krebs cycle, citric acid cycle, or TCA cycle. It involves the…
Q: A patient weighing 38.4 pounds presents with a bacterial infection and is prescribed a course of…
A: A multitude of bacterial infections can be treated with the antibiotic amoxicillin. These include…
Q: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids: 2. DNA:…
A: During the process of transcription, one strand of the DNA act as the template for the synthesis of…
Q: what does this picture indicate? what is difference bewteen A, B, and C ?
A: INTRODUCTION : Myoglobin - It is an iron and oxygen binding protein found in the skeletal &…
Q: The second high energy intermediate metabolite of glycolysis that can be used for substrate level…
A: Glycolysis is the biochemical pathway by which six-carbon glucose is converted to three-carbon…
Q: When doing automated sequencing, on the other hand, all 4 dideoxynucleotides are added to the same…
A: The genetic information is encoded in the sequence of DNA that is the genetic material. The Sanger…
Q: 0 I ОН CH2-CH-CH-CH-C-H ОН ОН ОН ОН
A: Chiral carbon is the carbon atom attached to four different substituents. If any carbon atom is…
Q: How many of the following statements are true? Allosteric enzymes display sigmoidal kinetics for…
A: Allosteric enzymes are enzymes that possess additional binding sites known as allosteric sites.…
Q: 31. Margarine is made from vegetable oil by a chemical process. Do you suppose this process converts…
A: Margarine is a product derived from vegetable oil, obtained by the hydrogenation,…
Q: 13. How would ATP production in an aerobic yeast culture change if we add the following metabolites…
A: Aerobic yeast culture is a metabolic process in which glucose is metabolize by fermentation even in…
Step by step
Solved in 2 steps
- Functional Consequences of Y-Family DNA Polymerase Structure The eukaryotic translesion DNA polymerases fall into the Y family of DNA polymerases. Structural studies reveal that their fingers and thumb domains are small and stubby (see Figure 28.10). In addition, Y-family polymerase active sites are more open and less constrained where base pairing leads to selection of a dNTP substrate for the polymerase reaction. Discuss the relevance of these structural differences. Would you expect Y-family polymerases to have 3-exonuclease activity? Explain your answer.Heteroduplex DNA Formation in Recombination From the information in Figures 28.17 and 28.18, diagram the recombinational event leading to the formation of a heteroduplex DNA region within a bacteriophage chromosome.Homologous Recombination, Heteroduplex DNA, and Mismatch Repair Homologous recombination in E. coli leads to the formation of regions of heteroduplex DNA. By definition, such regions contain mismatched bases. Why doesn’t the mismatch repair system of E. coli eliminate these mismatches?
- Semiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724 g/mL, 14N-labeled DNA has a density of 1.710 g/mL, and E. coli cells grown for many generations on 14NH4+as a nitrogen source are transferred to media containing 15NH4+as the sole N-source, (a) What will be the density of the DNA after one generation, assuming replication is semiconservative? (b) Suppose replication took place by a conservative mechanism in which the parental strands remained together and the two progeny strands were paired. Design an experiment that could distinguish between semiconservative and conservative modes of replication.The Enzymatic Activities of DNA Polymerase I (a) What are the respective roles of the 5 -exonudease and 3 -exonuclease activities of DNA polymerase I? (b) What might be a feature of an E. coli strain that lacked DNA polymerase I 3 -exonuclease activity?Cynt Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: $-ATGTATATCTCCAGTTAG-3" It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA 5- ATGTATCATCTCCAGTTAG-3' S-ATGTATATCTCCAGTTAG-3 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion O deletion point silent noisy insertion O deletion point silent Onoisy X G
- Given the following double-stranded fragment of DNA: 5'- ACTTGGCAGGCCTTCGATCC-3' 3'- TGAАССGTCСGGAAGCTAGG-5' A hypothetical restriction endonuclease recognizes a 6bp sequence with two-fold symmetry (typical for restriction enzymes) found in this fragment and catalyzes cleavage of this DNA on both strands between GG nucleotides within the recognition sequence. This nuclease exhibits b-type cleavage (atypical for restriction enzymes). Draw the double-stranded sequence of each fragment after cleavage showing any phosphates left on the ends.Step 1 Lys Lys Ligase-AMP NH2 NH2 NH2 `NH2 PP АТР он он OH Step 2 Lys Lys NH2 NH2 NH2 NH2 DNA- OH OH Adenylate OH OH HO. Step 3 NH2 NH2 NH2 NH2 AMP Phospho- diester OH OH OH OH OH Describe the mechanism shown above for DNA Ligase. Describe the chemistry of each step How the enzyme appears or might facilitate the chemistry How the enzyme increases the reaction rate.DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OH
- Both DNA polymerase (any DNA polymerase) and ligase catalyze the formation of a bond between nucleotides, but these two enzymes do NOT catalyze the same reaction. Briefly describe the differencesbetween the reaction catalyzed by the polymerase activity of DNA polymerase and the one catalyzed by ligase.The restriction endonuclease NotI recognizes the octanucleotide sequence GCGGCCGC. Calculate the expected number of NotI cleavage sites in the bacteriophage λgenome, a linear DNA duplex 48.5 kbp in length with a (G + C) content of 50%.In a standard procedire, when writing and reading base sequences for nucleic acids (both DNA and RNAs) always to specify base sequence in 5' > 3' direction unless otherwise directed 1. From the base sequence 5' A-T-G-C-C-A 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand 2. From the base sequence 5' T-A-A- C-C-T 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand