Q: 2. What link of a contour of biological regulation provides possibility of regulation "on a…
A: Introduction The contour of biological regulation:- It is a way for information processing &…
Q: Rehpogs are mythical creatures. They are small and not very smart. Rehpogs live on the ground in a…
A: A trait is a characteristic feature that is unique to particular individual . Each trait is…
Q: Write the species for the following:
A: The species is a taxonomic rank in biological classification that includes all the organisms which…
Q: Aside from using the autoclave, what are other ways to kill microorganisms from glassware that can…
A: * Culture media has to be sterilize before using it. * Sterilization is a process that destroys or…
Q: BLACK VESTIGIAL DIHYBRID TESTCROSS In the parental generation, you mate a pure-breeding wild-type…
A: If the genes are located on the same chromosome then they are classified as linked genes. In this…
Q: Caspases are involved in ___. Select one: a. protein dephosphorylation b. programmed cell death c.…
A: Ans- B) programmed cell death Programmed cell death is known as Apoptosis, which regulates the…
Q: In corn, pigmented aleurone (R) is dominant to colorless aleurone (r), and green plant color (G) is…
A: Given Green (G) is dominant over yellow (g) Pigment (R) is dominant colourless (r) Plant one…
Q: In the copies of each sequence below, divide the sequences into codons (triplets) by putting a slash…
A: DNA is a genetic material in most of the organism. It is two stranded ladder like structure which…
Q: Which of the following is not an example of artificial selection? (a) Your younger sibling got a…
A: Artificial selection is performed by humans. They try to breed the animals or plants in captivity,…
Q: Compare and contrast the acquisition and transport of water and nutrients in plants with the…
A: Introduction Nutrition is a process through which an organism acquire food necessary to generate…
Q: Compare and contrast convergent evolution and evolution by common descent, and give an example of…
A: Evolution is the process by which heritable traits change over time. There are two main types of…
Q: Discuss the effects of isotonic, hypotonic, and hypertonic environments on red blood cells and plant…
A: Osmosis is the net movement of water across a semipermeable membrane.
Q: Describe the theory of evolution, and name two ways that you can see it at work
A: It is the process of change in the heritable traits of a population over time. The organisms which…
Q: A= B= C= D= This diagram depicts a Gram what bacteria
A: The gram bacteria are of two types : gram positive bacteria and gram negative bacteria. A…
Q: Construct a cladogram from the data below.
A: A cladogram is also termed "phylograms", these are used to infer the relationship between different…
Q: What is the role of the mannose-6-phosphate (M6P) group? • What happens when M6P cannot be…
A: Mannose-6-phosphate is a molecule bound by lectin in the immune system. M6P is converted to fructose…
Q: 5. Ratios of the bases present in different samples of nucleic acid yielded the following results:…
A: Chargaff's rule states that in a double-stranded DNA or RNA, purines = pyrimidines.
Q: Please answer all the questions A Half-life of a hormone is a.the length of time it takes to…
A: The study of chemical reactions that take place within and relate to live beings is known as…
Q: Describe how coevolution, as with the hummingbird bill and hummingbird-pollinated flowers, is…
A: Coevolution is a multifaceted, intricate process. It can manifest in interactions among closely…
Q: Anatomically, the motor endplate potential is characterized by synaptic boutons active zones O…
A: Motor endplate-The specialized postsynaptic area of a muscle cell(myocyte). The motor endplate lies…
Q: Which of the following statements about convergent evolution is true? (a) It demonstrates how…
A: Evolution means an organism is keep evolving or bettering itself during the course of time. The gene…
Q: ANSWER BRIEFLY: Enumerate the 4 groups of coagulation factors according to function & opposite…
A: The coagulation term means the clotting of blood. The blood normally is in a liquid state, on…
Q: Give an example in your daily activities that illustrates each level of organization of ecological…
A: The "niche" of an organism is characterized by the set of conditions, resources, and interactions it…
Q: Which arrow in the diagram of transcription below is labeling the 'SENSE DNA strand? Note that the…
A: A DNA sequence is transcribed into an RNA molecule with the help of the enzyme RNA polymerase is…
Q: development of the genetically engineered foods (genetically modified organism or GMOs)? Find…
A: Genetically modified organisms are organisms in which the genetic material has been altered in a way…
Q: Which of the following is true about nucleosides and nucleotides? Choose all that apply. A…
A: Nucleosides and nucleotides are structural subunits of nucleic acids such as DNA and RNA.…
Q: You find that in a population of a butterfly species that that the frequency of allele 1 at the…
A: Hardy-Weinberg Equilibrium the formula is --- p² + 2pq+ q²= 1 p² = dominant homozygous frequency q²…
Q: NaCl (a salt) can disrupt protein structure. This is true because a protein containing the amino…
A: Glutamic acid is an amino acid that is used in the formation of proteins. It is converted to…
Q: What does “prezygotic” mean?
A: The processes of reproductive isolation are a group of behavioural patterns, physiological…
Q: We have 10 mL of cells to treat with Hydrogen Peroxide (H2O2), such that the final concentration of…
A: A stock solution refers to the concentrated form of chemical reagents which is diluted each time…
Q: What factors must be present for allopatric speciation to occur?
A: speciation is the process of evolution in which new, different species are formed. A single…
Q: The diagram represents a possible phylogenetic tree showing the relationship between the four…
A: The phylogenetic tree is the diagrammatic representation of the evolutionary relationship of the…
Q: How do microtubules act as a cytoskeleton? Are there times when they are particularly abundant?
A: A intricate web of protein filaments called the cytoskeleton is found in the cytoplasm of cells. It…
Q: The girl is focusing a slide and she is turning the coarse adjustment knob up toward the slide. A.…
A: An optical microscope has the following parts:- A stage for placing the slide A set of objective…
Q: What makes an experiment controlled?
A: Scientists test their hypotheses using controlled experiments. A hypothesis is an assumption, an…
Q: Describe the relevance of Bioinformatics in supporting the progress of Biotechnology.
A: Bioinformatics: Short for "biological Informatics", Bioinformatics is a new field of biotechnology…
Q: If you looked at H&E staining of a fungal-infected mouse tongue vs a non-infected mouse tongue,…
A: H& E stands for Hematoxylin and Eosin stain.This stain is used to observe various cellular…
Q: 1. Which cells in the life history of a basidiomycote can undergo meiosis? Dre CHA wr ?
A: A community is a collection of plants, animals, microbes, and fungi that coexist in a given area.…
Q: Construct a cladogram from the data below. Four Limbs X X Animals Frog Rodent Lizard Gorilla Fish…
A: Cladograms are branching structures that resemble trees and illustrate the shared links between two…
Q: 3. For every 3 turns of the Calvin Cycle, 1 molecule of G3P (Glyceraldehyde-3-Phosphate) is…
A: Calvin cycle is the light-independent process of photosynthesis that fixes carbon dioxide. It…
Q: Question 10 of 14 Which of the following are true about MHC class I and MHC class II peptide…
A: The statements which are true about Mhc class 1 and Mhc class two peptide loading are 1 : MHC class…
Q: substance that do not dissolve well in water are a. hydrophobic b. hydrophilic c.isotonic…
A: Introduction :- An substance that is attracted to water molecules and has a propensity to dissolve…
Q: immunosenescence.
A: Immunosenescence refers to the age-associated decline of the immune system which may contribute to…
Q: c. MPN = Tube Original sample 10-¹ 10-² 10-3 10-4 10-5 10-6 Dilution factor 1 1/10 1/100 1/1000…
A: Introduction No of bacteria present in a sample can be estimated by MPN (most probable number)…
Q: Why are the protein receptors on the egg cell particularly important among aquatic animals that use…
A: Fertilization is the process in which intermingling of male and female gamete fuse together and form…
Q: Which of the following is NOT a limitation of the current biological species concept? O Some…
A: According to biological species concept if two organisms can reproduce (mate) then they are…
Q: Which of the following processes and or mechanisms of evolution violate the assumptions of…
A: The Hardy-Weinberg principle states that a population’s allele and genotype frequencies will remain…
Q: Explain the steps in vesicle docking and fusion • What proteins are involved? What are their…
A: The science of cell structure and functioning is known as cell biology, and it is based on the idea…
Q: Domain(s) Presence of a nucleus Location of DNA Number of organelles Cell wall material Type of cell…
A:
Q: Population divergence occurring as a result of females in a species consistently choosing males of a…
A: Population divergence is an evolutionary process by which the population of inbreeding species,…
Step by step
Solved in 2 steps
- Using the “target DNA” sequence provided in the attached image, what sizes of inserts can be prepared using HindIII digestion? Which one contains the coding sequence?Restriction digestion and Gel electrophoresis: A single strand of a double-stranded DNA sequence is shown below. Draw a complementary DNA strand and show the restriction digestion pattern of the double-stranded DNA with BamHI and Pst1. Show the separation pattern of the undigested and the digested DNA on your agarose gel. Label the gel appropriately. 5’ – CGAGCATTTGGATCCTGTGCAATCTGCAGTGCGAT – 3’RESTRICTION ENZYME MAPPING Predict the result
- b. Cleavage with chymotrypsin produces the following fragments: Band A: CN , NLQY, GIVEQCCHKRSEY Band B: F, Y, DPTKM, IACCVRGF, RTTGHLCGKDLVNALY Cleavage with Staphilococcus aureus V8 protease produces the following fragments: Band A: GIVE, YNLQNYCN, QCCHKRCSE Band B: PTKM, RTTGHLCGKD, LVNALYIACGVRGFFYD What is the amino acid sequence of the protein? Type your responseUse the sequence provided and make use of figure 1 to determine what restriction enzyme uses the spesific recognition site and figure 2 and 3 to detremine how many times does the sequence occur in the λ DNA sequence? GGATCC: __________________________________________________________ GAATTC: ___________________________________________________________ AAGCTT: ___________________________________________________________Anglais Name and describe in detail three (3) disadvantages of differential centrifugation
- a)List and describe the purpose of each component of the restriction enzyme digest. b)Why do some tubes have no restriction enzyme?Why is it not advisable to use adhesive mixtures if protein histological inevstigations are contemplated.Name 4 steps that you can use to isolate a protein from a liver homogenate. Also, briefly discuss each method/step so that the basic principle of each step is clear.
- Write down a detailed description about the formation of polyacrylamide gel, how it is used for protein separations and the process of electrophoresis in these gels.The same restriction digestion experiment was repeated for EcoR1 on the same DNA molecule. However, the incubation period of the reaction was lengthened for an additional 2 hours due to some unforeseen circumstances. Illustrate below the results you would observe after gel electrophoresis and explain your findings.Discuss/explain/describe in detail the labeling reaction used to label your probe.