Flatworms show bilateral symmetry and some cephalization.   True   False   Some parasitic platyhelminths lost their digestive tract.    True   False   Platyhelminths can remove excess water out of the body.   True   False

Q: Describe what a pseudogene is and what impact they have on gene expression

A: A pseudogene is a nonfunctional gene that can be compared to junk DNA.

Q: 3 The experiment of Miller and Urey demonstrated that: That multicellular organisms form easily in…

A: Introduction The Miller-Urey experiment stimulated conditions thought at the time to present on…

Q: How can public health infrastructure components be managed and enhanced to improve the performance…

A: Good health allows individuals to maintain the strength and energy needed to participate in…

Q: Palivizumab is a humanized monoclonal anitbody for the prohylaxis of resporatory diseases caused by…

A: Palivizumab is a humanized monoclonal anitbody developed to help protect against respiratory…

Q: 4. As an object moves farther away from the eye, how does the lens change to keep the object in…

A: ANSWER) The human has the ability to accomodate the curvature in order to alter the focal length to…

Q: What are the major benefits and the disadvantages of a rumen system? How does a cecal animal compare…

A: Rumen system is the ruminant digestive system. Ruminants are those who eat plants- herbivorous…

Q: Patient is in severe stomach distress and is unable to swallow any meds due to vomiting, precise…

A: There are several routes of administration for drugs, including: Oral: This is the most common…

Q: Read the Guilty dentist information. Then use your understanding to answer the following questions…

A: In various research studies, people assume or predict to certain cause and effects called variables.…

Q: Respiratory droplets and aerosols are the same thing.   Question 19 options:   a) True   b) False

A: ANSWER) Aerosols are the smallest units of droplets, many aerosols come together to form a droplet.…

Q: Which of these conditions are always true of populations evolving due to natural selection?…

A: The mechanism by which communities of living things adapt and evolve is known as natural selection.…

Q: should be minimum one paragraph explaining statement Groups of organs with specific structures and…

A: An organ is a structure made up of different types of tissue that performs a specific function or…

Q: Directions: Use the Punnett Squares from the previous problems to answer these follow up questions.…

A: Note: “Since you have asked multiple questions, we will solve the first question for you. If you…

Q: O Lipid Functional protein Nucleotide Polysaccharide Monosaccharide Polymer Tertiary (protein)…

A: Five images labeled A, B, C, D and E are given and we have to assign  these images to the given list…

Q: what's the difference between research and scientific investigatory project?

A: Research is a kind of detailed study about something. It is done to have a better outcome and a…

Q: mussel lives in fast-moving waters.    Question 2 options:   Dark coloured shell   Heavy, thick…

A: Adaptations that likely indicate a mussel lives in fast-moving water is-------- Increased number of…

Q: OBJECTIVE: This assignment is to evaluate learners' analytical skills in exploring the importance of…

A: This project aims to assess students' analytical abilities as they investigate the significance of…

Q: Using the same traits as the previous question, determine the phenotype of an obese mouse that is…

A: In the given case, the genotype of one parent would be “Kknn” and the genotype of another parent…

Q: Extracellular recordings create a distinct action potential. Choose the option that best describes…

A: Action potential is a kind of impulse that arises due to the stimulation of the neuron. It consists…

Q: Animal fats for saturated fats are liquid at room temperature and include foods like olive oil, fish…

A: 2. Fats are an essential macronutrient that are important for many bodily functions, such as…

Q: 1. A stain turns one bacterium green and a different bacterium blue. This would be called a gram…

A: Some bacteria can cause disease in humans, animals, and plants. Examples of harmful bacteria include…

Q: 4. In humans, brown eye color (B) is dominant to blue eye color (b). A woman who is homozygous…

A: An allele is one of two or more variations of a certain gene. A dominant allele can only show itself…

Q: 2. On a sunny day, you enter a dimly lit room and see an apple. At first, the apple looks like the…

A: ANSWER) The illumination of the objects is determined by the diameter of the pupil, larger the…

Q: Which of the following is true about antigen presentation, MHC involvement or T cell activation?…

A: Introduction = Major Histocompatibility Complex- Cluster of genes found in all mammalsIts products…

Q: 4. The punnett square below shows brown eyed mom and blue eyed dad. Complete the punnett square…

A: A Punnett square is a graph that makes it simple to ascertain the predicted proportion of various…

Q: Genetic and genomic research can have social and environmental implications.

A: Genetic modifications do have environmental implications which can be observed from the given graph.…

Q: Considering both habitat conditions and requirements for successful symbiosis, why should you be…

A: The question is asking about the potential similarities in the microbial symbiots found in two very…

Q: 3. Using this chart as support, explain why most plants, algae, and photosynthetic bacteria appear…

A: ANSWER) Photosynthesis is the process by which the plants, cyanobacteria and algae use the carbon…

Q: The waved albatross feeds exclusively on marine organisms and has no access to fresh water. It has…

A: Albatrosses have salt glands just behind their eye sockets. This salt gland allows them to get rid…

Q: Any break in the chain of infection prevents the spread of disease.   Question 4 options:   a)…

A: True.

Q: What is one of the determining factors in the three-dimensional structure of a protein?   A.The…

A: Introduction:- There are different types of bio-macromolecules and bio-micromolecules present in…

Q: 2. A diploid human cell contains approximately 6.4 billion base pairs of DNA. a. How many…

A: Histones are highly basic proteins that provide support and shape for a chromosome. Core histones…

Q: What advantages are there to using plant associated microorganisms rather than animal associated…

A: Xanthan gum is a polysaccharide food ingredient derived from the bacterium Xanthomonas campestris…

Q: Consider three yellow, round peas, labeled A, B, and C. Each was grown into a plant and crossed to a…

A: Introduction A gene exists in two alternative forms called alleles. If both the alleles are same, it…

Q: which products of the light independent reactions are used by the light dependent reactions

A: Photosynthesis is the basis of the food chain in terrestrial and aquatic ecosystems; it supports the…

Q: Explains, with several scientifically detailed information, how global warming affects the beélugas…

A: Global warming is the rise in global mean temperature.Global warming occurs because of increase in…

Q: Examine the following "field of view" and determine what the size of the object is.

A: Field of view is the maximum area where one can focus .

Q: You isolate ten new mutant yeast strains that are defective in synthesis of leucine, an amino  acid.…

A: In this scenario, you have isolated ten new mutant yeast strains that are defective in the synthesis…

Q: Unambiguous Nonoverlapping ○ Universal 4. The promoter region contains a consensus sequence where…

A: The promoter region is a specific DNA sequence located upstream of a gene that is responsible for…

Q: 8. At the conclusion of the Krebs Cycle, glucose is completely broken down, yet only a net of…

A: The Krebs cycle begins when acetyl-CoA reacts with a four-carbon molecule known as OAA…

Q: Evolution is biology's 's core theme that ties together all the other themes. This is because…

A: 1.) According to the RNA world hypothesis life on earth began with a simple RNA molecule that could…

Q: In your own words , Explain the structure of the nasal cavity, trachea and alveoli. Linking their…

A: Introduction:- The primary function of the respiratory system's major organs are to eliminate carbon…

Q: What are the genotype and phenotype ratios of potential offspring when a man with type AB blood…

A: Blood groupings are inherited. They follow a Mendelian pattern, which means they are the result of a…

Q: 1. Types of transport of substances through the membrane: passive transport (facilitated diffusion…

A: Introduction Transportation across the cell membrane can occur via active or passive transport. The…

Q: 2. Consider the energy systems an 800m track athlete would use during a race. In a scenario where…

A: a) During the first 400m of the race they feel strong and quick because the warm up helps them to…

Q: how many nucleotides are in CAGATTGTGAAGAGGTCTCTTGA consensus coding sequence? Answer in numerical…

A: Nucleotides are organic molecules made up of a phosphate and a nucleoside. They function as…

Q: 18. Consider a Pompeii worm that lives very deep below the ocean's surface, on the ocean floor. What…

A: Pompeii worms retain their heads (including the gills) in considerably colder water while exposing…

Q: 3. Beetles of a certain species may have green, blue, or turquoise wing covers. Virgin beetles were…

A: Gene It refers to the basic unit of heredity which is passed from parent to progeny. It constitutes…

Q: Explains how the beluga population in Canada was affected. (With more than 700 words)

A: Beluga whales can be found all over the world in the Arctic and sub Arctic waters, as well as in…

Q: one of the first flowers seen in the spring in some regions of the United States. The flower is…

A: Epistasis is a mechanism where an effect of a gene mutation is dependent on the presence or absence…

Q: What is the role of mRNA in protein biosynthesis process? Transfers amino acids to ribosome To bring…

A: Cells create proteins through a mechanism known as protein synthesis. Transcription and translation…

Animal Phylogeny

Cladistics is a method of biological classification where organisms are classified based on their ancestors and their relationship with them. It is defined as the concepts and methods for determining the branching patterns of evolution and evolutionary history. Some scientists, however, have preferred the term phylogenetic systematics or phylogenetic taxonomy to emphasize the reliance on a phylogeny for classification. It is the most common and accepted method for classifying organisms.