H2SO4 C2H2F2 Give all 3 possible structures

Q: is Fe2+(aq) + 2OH−(aq) → Fe(OH)2 (s) an oxidation reduction reaction

A: No, the reaction Fe2+(aq) + 2OH−(aq) → Fe(OH)2 (s) is not an oxidation-reduction reaction. In an…

Q: Which of the carbon atoms shown displays the signal that is the most downfield in the 13C NMR…

A: I : The shift will be around 110- 140 ppmII : The shift will be around 190-220 ppmIII : The shift…

Q: A major component of gasoline is octane  C8H18 . When octane is burned in air, it chemically…

A: We know Molar mass of octane = 114.23 g /molOxygen gas consumed = 9.92 gMolar mass of oxygen =…

Q: Chemistry

A: Step 1:Step 2: Step 3: Step 4:

Q: The compound G's 1H-NMR spectrum is shown below. Assign the spectrum (feel free to just use arrows…

A: For the 1H-NMR Spectrum:For the peak at around 1.27 ppm these hydrogens are the most shielded.…

Q: None

A: This is an excerpt from an academic journal article about TymeBank, a digital bank in South Africa.…

Q: For each atom in the table below, write down the subshell from which an electron would have to be…

A:

Q: S. Don't provide handwriting solution

A: Approach to solving the question: Detailed explanation:  Examples: Key references:

Q: Consider the E1 elimination products. Draw the minor product. Br Ꭰ H₂O

A: The major product is the Zaitsev product in which most substituted alkene is formed by eliminatin  a…

Q: Using the blank graph space below, draw an energy diagram/profile for a reaction that includes the…

A:

Q: Draw the major product of this reaction. Ignore inorganic byproducts.

A: Step 1: Step 2: Step 3: The Michael addition reaction is nucleophilic addition to unsaturated…

Q: None

A: Approach to solving the question:By definition, ketohexoses are a class of carbohydrates that have 6…

Q: . Which of the following compounds can exist as cis-trans isomers? Draw each cis-trans pair.a)…

A: Step 1:Cis-trans isomerism (geometrical isomerism) is shown by alkenes when different groups are…

Q: Consider the following cell reaction: Ni(s) + 2 H+(? M)-Ni2(1.00 M) + H2(g)(1.00 atm) If the cell…

A: Thank you.

Q: :&;$;$$;$;:$:$

A: Step 1: (I)Step 2: (II)Step 3: (III)Step 4: (IV)Step 5: (V)

Q: Draw a reasonable arrow-pushing mechanism for the transformation shown. Please be certain to adhere…

A: Approach to solving the question: Detailed explanation: Examples: Key references:

Q: Answer the questions in the table below about this molecule:

A: Detailed explanation:Identification of the Molecular Structure: The molecule presented,…

Q: Which of the following reactions will occur spontaneously as written?     3Fe (s) + 2Cr3+ (aq) →…

A: Step 1:Step 2:Step 3:

Q: dont provide handwriting solution....

A: The portions of 1,2,3-Trichloropropane that interact differentially with water molecules are…

Q: Which orbital diagram represents the electron configuration of the low-spin octahedral complex…

A:

Q: Draw the structure of the ethyl acetate and name using the IUPAC system. Compare your 1H NMR with…

A: The information provided earlier and offer a more comprehensive response combining structure, IUPAC…

Q: 2 sources of possible experimental errors encountered during Thin Layer Chromatography would be?

A: THINGS TO REMEBER: Careful technique and attention to detail can help minimize these and other…

Q: a. ОН ОН hv light

A: Approach to solving the question:The given reaction, is [2+2] cycloaddition, will go through Diel's…

Q: 1. Draw the structures of the constitutional isomer of the following molecular formula:a) C8H18b)…

A: 1.a)one constitutional isomer is octane    CH3(CH2)6CH3  . This is a straight-chain alkane with 8…

Q: Please solve this chemical equation

A:

Q: 1,3-Cyclopentadiene has to be used quickly after it is made, or stored cold. Which reaction below is…

A: cyclopentadiene reacts with water and produces the 1,2 addition. In the above reaction,…

Q: What changes can be  made  to the hydrogenation reaction to make it safer for beginner students?

A: Based on the information which you have provided in question, which depicts a step in the transfer…

Q: Bro not hand written solution

A: μStep 1:Step 2: Step 3: Step 4:

Q: Identify the Brassicasterol peak of the GC-MS of Burn Morel mushrooms (Tomentosa) and the M (+/-)…

A: The Brassicasterol peak or the M (+/-) peaks from the image you sent. The image contains a graph but…

Q: Bearing in mind possible functional group incompatibilities, which reagent set would work the best…

A:

Q: 1. How much heat energy, in kilojoules, is required to convert 74.0 g of ice at −−18.0 ∘C to water…

A: Given:mass of ice = 74.0gInitial temperature of ice = -18°Cfinal temperature = 25.0°CSpecific heat…

Q: Please don't provide handwritten solution.

A: Detailed explanation:Understanding the Relationship Between Isomeric Structures in Organic…

Q: Step by step full solution

A: Step 1:  The electrophilic carbon atom (the carbon atom that has a chlorine connection to it) is…

Q: The preparations of two aqueous solutions are described in the table below. For each solution, write…

A: Step 1:In an aqueous solution, an acid is a compound that produces hydronium ions H3O+ while a base…

Q: What is the pH of a 0.420 M solution of HF (Ka = 6.8 × 10-4)?

A: Given: [HF]=0.420M;Ka​=6.8x10−4;pH=???Step 1: Write the dissociation of…

Q: Ca(NO3)2 , CuSO4 Molecular equation Total ionic equation Net ionic equation

A: Steps to write the equations:Step 1:Word equation: The equation which is wrote using the chemical…

Q: [Review Topics] [References] Draw structures for the carbonyl electrophile and enolate nucleophile…

A: Step 1:Enolate nucleophile is formed after loss of an alpha hydrogen from propanone.   Step…

Q: Be sure to answer all parts. Complete the reactions to show how the following product can be…

A:

Q: a segment of dna has the following sequences of bases ATGCAATGATATTGAAGCTTA

A: The DNA segment you've provided, "ATGCAATGATATTGAAGCTTA," is composed of nucleotide bases. These…

Q: Identify the major product of the following reaction. OH H excess CH3CH2OH [H+] - H₂O ?

A: In case of any doubt please feel free to ask.

Q: Identify the major product of the following reaction. OH H excess CH3CH2OH [H+] - H₂O ?

A: Attached the visual representation of he aldehyde group (CHO) of the starting molecule will react…

Q: Identify the Campesterol peak of the GC-MS of Burn Morel mushrooms (Tomentosa) and the M (+/-) peaks…

A: I can identify the Campesterol peak, M (+/-) peaks, or the mass and signature intensities of the…

Q: Show the mechanism and give the expected products for the following reaction.

A:

Q: A weak acid has K₁ = 1.13 x 10-⁹. What is the pKB of its conjugate base? Answer:

A: Thank you

Q: 7. What is the major product? NaOH c. ? a. b. d. e. not a.-d.

A: Step 1: **Substitution Nucleophilic unimolecular reaction, or SN1 :**  1) There are two stages to…

Q: Problem 27 of 27 Submit Prontosil is an antibacterial sulfa drug. Provide the intermediates,…

A: Step 1:Prontosil is an antibacterial drug of the sulfonamide group.  Step 2:

Q: dont provide handwriting solution ..

A:

Q: Write balanced half-reactions for the following redox reaction:…

A:

Q: I am stuck on solving, how do I set up?

A:

Q: Give the IUPAC name of the product formed in the following reaction of ethyl cyclopentanecarboxylate…

A: The reaction is a base-catalyzed hydrolysis of ester or simply saponification.In this reaction, it…