KINETIC CONSTANT No Na2HPO4 25mM Na2HPO4 50mM Na2HPO4 Vmax nmol p-NP. Min- 20.3252 14.30615 17.30104 Km mM -0.819106 -0.46495 -0.352941 1. What does this suggest about the structure of the active side of the enzyme?
Q: Which of the following laws of matter best describes the statements on sulfide minerals? Select one:…
A: INTRODUCTION : Sulfide minerals - They are a class of minerals consisting of sulfide or disulfide…
Q: Complex carbohydrates are comprised of which of the following? Disaccarides Oligosaccarides…
A: Carbohydrates are biomolecules composed of carbon, hydrogen, and oxygen. Carbohydrates are…
Q: Which sequencing project(s) would be done better using a next generation method (like Illumina)…
A: Sanger sequencing method - it is also known as chain termination method of gene sequencing. This…
Q: Identify three enzymes and the scientists who worked on them. What are the importance of these…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: What is binding energy? What do negative and less negative energies represent? How does this relate…
A: Binding energy is the amount of energy required to separate a system into its constituents. If we…
Q: More energy comes out of glucose degradation if pyruvate proceeds to the mitochondria for oxidative…
A: Degradation of glucose is termed as glycolysis which is a catabolic pathway in which 6 carbon…
Q: DNA: Explain nick translation and strand displacement
A:
Q: Given the following reaction below, what amino acid is involved and what is the specific reaction…
A: Phenylalanine, tyrosine, and tryptophan are aromatic amino acids. The side chain of the…
Q: Question 20 of 25 The figure below illustrates what reactions of amino acids? coo C=0 CH₂ CH₂ =0 00…
A: Amino acids are the building blocks of proteins. they exhibit different physical and chemical…
Q: xplain the indirect effect that allosteric effectors have on pyruvate dehydrogenase activity through…
A: The pyruvate dehydrogenase complex acts a a connection between glycolysis, the tricarboxylic acid…
Q: d) Alcohols usually don't behave as a weak acids, but tyrosine does. Explain why Y ionizes, while S…
A: Note: Hi! Thank you for the question. We are authorized to answer one question at a time. Since you…
Q: a. Provide names for both metabolites. b. What kind of reaction occurs here? c. What enzyme…
A: Biochemical reactions are catalyzed by enzymes in which bio-metabolites are transformed into another…
Q: The value of kcat for N-Ac-Phe-OC₂H5 is two-fold greater than that for the L-tryptophanyl analog and…
A: Chymotrypsin catalyzed peptide bond hydrolysis takes place in 2 phases after the enzyme binds the…
Q: Based on the structure of sucrose below, is it classified as a reducing sugar? 6CH OH ОН ОН 3…
A: Chemically, carbohydrates are polyhydroxy aldehydes/ketones. They have the general formula :…
Q: H K Br Br H trans-2,3-dibromo-2-butene cis-1,2-dibromoethene Otrans-1,2-dibromoethene…
A: The structure given the question represents- Answer- trans - 1,2- dibromoethene
Q: Select the correct response:
A: Tyrosine gives rise to catecholamines which includes dopamine, norepinephrine, and epinephrine.
Q: Consider the pyruvate carboxylase reaction, the first bypass step in gluconeogenesis: Pyruvate + CO₂…
A: Gluconeogenesis is a process by which cells make glucose from non carbohydrate sources.…
Q: Question - is if the cells in our bodies were to convert the required energy into our food substance…
A: Energy must be supplied continuously for living things to exist. This energy is employed in part to…
Q: 2. What sample shows a positive result with the Molisch Test? Why did this sample give a positive…
A: Note: Please note that we are supposed to give answer only for the first question. so providing…
Q: Name three metabolic processes in the cell that are enhanced and two that are inhibited in response…
A: Insulin is a peptide hormone released by the beta cells of the pancreas. The key function of insulin…
Q: Fumerase is an enzyme in the citric acid cycle that catalyzes the conversion of fumerate to…
A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…
Q: Canonical forces in protein folding. Describe how these forces come into play when a protein folds.
A: INTRODUCTION : Canonical forces in protein folding - Canonical forces are those forces which…
Q: 0 I ОН CH2-CH-CH-CH-C-H ОН ОН ОН ОН
A: Chiral carbon is the carbon atom attached to four different substituents. If any carbon atom is…
Q: 1. What two enzymes in glycolysis are regulated by high ATP concentrations?
A: INTRODUCTION : Glycolysis : It is a metabolic pathway in which glucose is breaken down into pyruvate…
Q: 4. Below each item, identify WHAT it is, indicate WHERE in the cell it is used/made (cytoplasm or…
A: Glycolysis is the metabolic pathway that converts glucose into pyruvate. The free energy that is…
Q: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids:
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: Submit a drawing of the following phospholipid: -x-group is phosphoserine (use google if you need…
A: Glycerophospholipids or phospholipids are lipids found in the biological membrane. In phospholipids,…
Q: 3. Given the following peptide sequence, GSICDNCR, the estimated net charge at the given pH is: a)…
A: Peptides: Organic substances known as amino acids include both amino and carboxylic acid functional…
Q: Why carbon C-2 and C-5 are mark? why not just ona carbon is marked since just one carbon was marked…
A: Gluconeogenesis is the synthesis of glucose molecules from non-carbohydrate sources such as…
Q: Biochemical events in the synthesis of ATP: I. Subunits of ATP synthase chages in conformation and…
A: ATP synthase is a complex enzyme consists of an F0 and F1 components. It uses the proton motive…
Q: How many of the following statements are true? Allosteric enzymes display sigmoidal kinetics for…
A: Allosteric enzymes are enzymes that possess additional binding sites known as allosteric sites.…
Q: Question 15 of 25 Which of the following is true for the acid-base properties of amino acids? Select…
A: Amino acids are the building blocks of proteins . they have two functional groups amine group and…
Q: Question 23 of 25 Among the given statements, which ones describe the lysosomes? Select the correct…
A:
Q: What is the total yield of NADH, FADH2, and acetyl-CoA from the complete oxidation of myristate?…
A: Myristic acid is a fatty acid with 14 carbon atoms. Beta-oxidation is the oxidation of fatty acid on…
Q: What effect does a negative effector have on the graph of reac- tion rate (V) vs. [substrate] for an…
A: INTRODUCTION : Allosteric enzymes : Allosteric enzymes are those enzymes which have an additional…
Q: Please write down the DNA sequence inferred from the below DNA gel. Shown are the products of a…
A: DNA is the genetic material in most living organisms. The information in a DNA molecule is encoded…
Q: Explain why a positive control and negative control are included in PCR experiments. Explain the…
A: PCR is a laboratory technique that is used for making large number of copies of a target DNA…
Q: 6.) Calculate the concentration (N) of arsenic acid (H3A504) in a solution if 25mL of that solution…
A: Given that, Volume of 0.1894 molar KOH required to neutralize anseric acid is 35.21 mL. Volume of…
Q: Identify the major and minor grooves in the DNA molecule PDB ID 141D. In addition, one end of a…
A: DNA is two strands of polynucleotide linked to each other in an antiparallel direction by hydrogen…
Q: For the questions below be sure to show your work as well as the answer to the question. In this…
A: Hi! Thank you for the question. We are authorized to answer five subparts at a time, since you have…
Q: Explain the principle involved for Tollen’s test.
A: Tollen's test is used to differentiate between the two carbohydrates with an aldehyde group or…
Q: Cycle of tricarboxylic acids (TCA): • importance for cellular metabolism; • intracellular…
A: It is a step wise cyclic but complete oxidation and decarboxylation of of active acetate group to…
Q: Use the data below to answer the following question: How much more energy is stored in a gram of fat…
A: A heterogeneous class of substances with comparatively similar physical characteristics are referred…
Q: discuss the biochemistry behind disorders related to aromatic amino acids with the aid of an…
A: Metabolic disorders are caused due to abnormalities in one or more processes in a metabolic pathway.…
Q: 6. Study the cycle below and answer the following 6.1 Provide a definition for the citric acid cycle…
A: - The Krebs cycle, also known as the TCA cycle (tricarboxylic acid cycle) or the Citric acid cycle,…
Q: What is the property/characteristics of DNA that makes it insoluble to ethanol/isopropyl alcohol?
A: The mechanical separation of the nuclear contents from the remainder of the cell, accomplished by…
Q: The net yield of ATP for the complete oxidation of one molecule of glucose is O 10 ATP O 24 ATP O 30…
A:
Q: Q6.1: Three critical features of enzyme structure and function contribute to the overall efficiency…
A: The enzymes are biological catalysts that increases the rate of biochemical reactions. The enzymes…
Q: 4. Transketolase transketolase requires a lysine in the active site while requires the cofactor TPP.
A: Transketolase is an enzyme that connects the pentose phosphate pathway to glycolysis. This enzyme is…
Q: 1. The peptide below was isolated from fermented milk and shown to have antioxidant properties…
A: Peptide is polymer of amino acids linked by peptide/amide (covalent) bond with release of a water…
Step by step
Solved in 3 steps
- The enzyme lysozyme hydrolyzes glycosidic bonds in peptidoglycan, an oligosaccharide found in bacterial cell walls. The active site of lysozyme contains two amino acid residues essential for catalysis: E35 and D52. Which of the following statements about lysozyme is true? More than one may apply The graph shows the pH-activity profile of lysozyme. 100 50 4. 6. 8. 10 pH Residue E35 exhibits general base catalysis O The pKa of E35 is approximately 4.3 O The pKa of D52 is approximately 4.5 O The optimal activity of lysozyme is approximately 5.2 Residue E35 exhibits covalent catalysis The pka of E35 is approximately 6.1 The pka of D52 is approximately 3.7 Activity (% of maximal)Chymotrypsin has the highest affinity for which of the following substrates: Table. The values of KM and kcat for some Enzymes and Substrates Enzyme Chymotrypsin Ки (М) 4.4 x 10-1 8.8 x 10-2 6.6 x 104 Kcat (S-1) 5.1 x 10-2 1.7 x 10-1 1.9 x 102 Substrate N-acetylglycine ethyl ester N-acetylvaline ethyl ester N-acetyltyrosine ethyl ester Catalase H2O2 2.5 x 10-2 1.0 x 107 Urease Urea 2.5 x 10-2 4.0 x 105 OA. N-acetylglycine ethyl ester OB. N-acetylvaline ethyl ester OC. N-acetyltyrosine ethyl ester D. UreaChitinase is a protein that breaks down chitin, a primary component of the cell wall in fungi, scales in fish and exoskeletons of arthropods. The activity of chitinase extracted from a plant was shown to be optimum at pH 5. You were tasked to prepare 300 mL of 150 mM buffer solution for further analysis of the extracted chitinase. REAGENTS Ka 2.5M Acetic acid Solid NaOAc•3H2O [136.08g/mol] 1.76 x 10-5 2.5M NH3 Solid NH4Cl [53.49g/mol] 5.6 x 10-10 2.5M Lactic acid Solid sodium lactate [112.06g/mol] 4.0 x 10-5 5 M HCl 5M NaOH Pls show sol'ns 1. Given the following reagents, give the moles of each component (acid & base).2. What are the mass/volume of the components needed to prepare the buffer? 3. What will the pH of the buffer be if 1mL of 5 M NaOH was added?
- A certain plant storage protein, after being isolated, was digested using both 8N H2SO4 and conc. Ba(OH)2. The resulting hydrolysates were then analyzed for amino acid composition using paper chromatography with EtOH-NH3-H2O (80:10:10) as the solvent system and ninhydrin as the visualizing agent. Name the amino acids found in the acid hydrolysate labelled 1-5.In the hexokinase reaction (in glycolysis) Keq caclualtion, what is the OBVIOUS problem with getting a Keq of 678? what should keq be normally? how can you EXPLAIN a Keq of 678?A synthetic substrate, the para-nitrophenylacetate (PNPA), is used to monitor enzyme activity of protein P. The product of the hydrolysis reaction absorbs at 410 nm with a molar extinction coefficient of 4 000 M-¹.cm-¹. 1- Write the reaction catalyzed by the protease P using the pNPA substrate. 2- The enzyme extract is too concentrated and a 1/300 dilution is needed for enzyme tests. Considering that you would need at least 600 µL of diluted enzyme extract for activity tests, indicate which volume of buffer and enzyme extract you must use for the dilution.
- His388 Glu357 His388 Glu357 Ring opening Proton HO HO abstraction HO но- G6P He NH- NH His388 His388 His388 Glu357 Glu357 Glu357 HO но HO но- но OH cis-enediol F6P Ring closure intermediate OH Describe the mechanism shown above for phosphoglucose isomerase. Describe the chemistry of each step • How the enzyme appears or might facilitate the chemistry How the enzyme increases the reaction rate.The active site of lysozyme contains two amino acid residues essential for catalysis: Glu35 and Asp52. The pKa values of the carboxyl side chains of these residues are 5.9 and 4.5, respectively. What is the ionization state(protonated or deprotonated) of each residue at pH 5.2, the pH optimum of lysozyme? How can the ionization states of these residues explain the pH-activity profile of lysozyme shown below?The protein catalase catalyzes the reaction 2H,O,(aq) — 2H,O(l) + O,(g) and has a Michaelis-Menten constant of KM = 25 mM and a turnover number of 4.0 × 107 s¯¹. The total enzyme concentration is 0.010 µM and the initial substrate concentration is 4.83 µM. Catalase has a single active site. Calculate the value of Rmax (often written as Vmax) for this enzyme. Rmax Calculate the initial rate, R (often written as V), of this reaction. R = ×10 mM.s-1 mM-s-1
- The enzymatic activity of lysozyme is optimal at pH 5.2 and decreases above and below this pH value. Lysozyme contains two amino acid residues in the active site essential for catalysis: Glu35 and Asp52. The pK value for the carboxyl side chains of these two residues are 5.9 and 4.5 respectively. What is the ionization state of each residue at the pH optimum of lysozyme? How can the ionization states of these 2 amino acid residues explain the pH-activity profile of lysozyme?at what substrate concentration is v= 5.0 mM s^-1 for the enzyme catalyzed hydrolysis of trehalose?The active site of an enzyme that uses a general acid-base catalytic mechanism contains a Glu and an Asp residue (both of which are essential for catalysis) with pKa values of 5.9 and 4.5, respectively. If the enzyme is found in the lysosome (pH = 5.2), which residue will act as the general acid and which will act as the general base during the initial steps of the reaction?