Mating Ste12 Tec1 Budding 17. (8 points) Scientists are studying the transcription factors Ste12 and Tec1. They have found that when ste12 binds to one part of the genome alone it activates the transcription of genes important in mating pheromones. They also found that when Tec1 binds to another part of the genome alone it activates the transcription of cellular budding genes. Lastly, they found that in another part of the genome, Ste12 and Tec1 both bind to the DNA, they activate the transcription of genes that control the formation of filaments. a) These proteins bind to enhancers. Is Ste12 and Tec1 activators or mediators? How do you know? Filamentation b) Is this system an example of combinatorial control or coordinated control, both or neither? Explain your answer. sold ad bosow
Q: You cross two wildtype (short-tailed) chipmunks, and collect a male offspring with a particularly…
A: Genomic imprinting is an epigenetic process in which alleles are expressed differently depending on…
Q: What direction does DNA polymearse only travel in?
A: The question is asking about the directionality of the enzyme DNA polymerase during the process of…
Q: for the table below make a graph call it Factors vs Rate of Enzyme Activity rules: data points…
A: Approach to finding a solution to the problem:1. Collect the information that is included in Table…
Q: Which stain is used to diagnose hairy cell leukemia? Question 14 options:…
A: The objective of the question is to identify the specific stain used in the diagnosis of a type of…
Q: 7:09 PM Wed Apr 10 Three strains of green-seeded lentil plants appear to have the same phenotype.…
A: Part C: It is suggested that one gene with two alleles (dominant and recessive) is segregating by…
Q: Explore the differences between positive inducible, positive repressible, negative inducible, and…
A: When an inducer molecule binds to a repressor protein, it undergoes a conformational shift that…
Q: What kind of dentition do new world monkeys have? What kind of food do they eat and how do their…
A: New World monkeys have a distinct dentition compared to Old World monkeys (apes and humans…
Q: In most parts of the world, commercial potato crops are produced asexually by planting tubers.…
A: Growing potatoes mainly includes asexual generation through planting tubers. This strategy is…
Q: What are the benefits of multi-management protected areas as compared with strictly protected areas?…
A: They are more likely to benefit local people and thus earn local support: Multi-management protected…
Q: Anaerobic respiration requires great stores of glycogen requires extensive capillaries for oxygen…
A: The question is asking about the requirements and role of anaerobic respiration in human energy…
Q: Facilitated diffusion and active transport are two different mechanisms that the cells use to…
A: Answer well explained above
Q: A wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the…
A: To explain--M1: Met-Ser-Ser-Arg-Leu-Glu-GlyThis mutation involves the substitution of Pro with Ser.…
Q: What is photosynthesis?
A: Photosynthesis is a biological process that occurs in green plants, algae, and some bacteria. It is…
Q: An athlete tested positive for Methylhexaneamine in urine with a level of 0.90 µg/mL. At her appeal…
A: In competitive sports, the accuracy and reliability of doping tests are fundamental due to their…
Q: Answer the following questions regarding the diagram (below) showing translation. The ribosome is…
A: “Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: When joining two or more DNA fragments, a researcher can adjust the sequence at the junction in a…
A: In molecular science, the control of DNA is central to numerous experiments and innovations,…
Q: Station 6: The Miocene: Gigantopithecus Gigantopithecus, which means “giant ape”, has been found in…
A: The objective of this question is to compare the dental and jaw structure of Gigantopithecus, a…
Q: In what stage of mitosis is the cell labeled "A"? A shutterstock B www.shutterstock.com 159810452 O…
A: During metaphase, which is a crucial stage of mitosis, the cell undergoes several key events as it…
Q: PCR & High-Throughput Sequencing A. What are the three steps of PCR, including temperatures, (or…
A: A. Further explanation of the three steps of PCR:1. Denaturation: The high temperature used in…
Q: please solve this step by step with clear explaination
A: To convert the given amounts of DNA from micrograms (μg) to microliters (μl), we need to use the…
Q: Please define each term in the figure Laser beam Vaporization Coagulation Carbonization Hyperthermia…
A: Laser innovation in therapeutic medicines, especially in surgeries, has revolutionized precision and…
Q: In which direction would an MRI scanner move to produce sequential images of the body in the frontal…
A: The MRI (Magnetic Resonance Imaging) scanning refers to an apparatus, wherein the magnetic fields…
Q: What does CaMKII do? A. It displaces magnesium and therefore permits glutamate to open calcium…
A: The basic enzyme in neural signalling, calcium/calmodulin-dependent protein kinase II (CaMKII), is…
Q: What is suspected when the hematocrit has decreased by 4% and the total bilirubin level is increased…
A: The objective of the question is to identify the possible medical condition based on the given…
Q: Which of the following is NOT an adaptation among plants to increase access to nitrogen?…
A: Mutualistic association with fungi that convert atmospheric nitrogen into a biologically available…
Q: Students filled three identical flasks with water and placed elodea, a type of aquatic plant, in…
A: Explanation:The presence of dissolved oxygen in water is closely related to the process of…
Q: Choose all the items that catalyze the phosphodiester bond. - enhancer - promoter - activator…
A: The objective of the question is to identify the biological entities that can catalyze the formation…
Q: DATA ANALYSIS 1. What electrical and mechanical events correlate to the P wave? The QRS complex? The…
A: Detailed explanationQuestion 1The P wave is the electrical signal that causes the atrium to…
Q: -Centromere D D Ø ☹ A B ℗ ℗ D E C
A: The objective of the question is to determine the chromosomal condition of a daughter nucleus at the…
Q: All of the following are TRUE of a vertebrate whose blood flows directly from the respiratory organs…
A: The question is asking us to identify the incorrect statement about a vertebrate whose blood flows…
Q: What differences do you notice between the male and female forms of extant apes?
A: Extant apes are the apes that are still alive today. There are six extant ape species: gorillas,…
Q: 2 OF 11 QU Answer all that apply. Traditionally, the Out of Africa Model of modern human origins…
A: The Out of Africa Model, also known as the "recent single-origin hypothesis" or "Replacement Model,"…
Q: Question 7 Take Quiz Exit 0.5 pts The only force of evolution that adds new gene variants to the…
A: Question 7The correct answer is A. Mutation.Explanation:Mutation: Mutation is the only force of…
Q: If you were educating expecting parents on pregnancy, labor and delivery, as well as the first year…
A: Pregnancy:Prenatal Development:This section outlines the stages of fetal development during…
Q: Write about Pfizer-BioNTech COVID-19 vaccine (Tozinameran) You must include the following…
A: Drugs are fundamental for preserving wellbeing, controlling symptoms, treating diseases, and…
Q: What does it mean for something to be selectively toxic? Which is more challenging to produce, a…
A: Due to the fact that it is required for medications and chemicals to only cause harm to the…
Q: What is the role or function of mitosis and meiosis in formation of the sperm and egg cell?
A: The objective of the question is to understand the role of mitosis and meiosis in the formation of…
Q: Phytoremediation is the utilization of plants in the clean up of a polluted area. In a maximum of…
A: Phytoremediation is a cost-effective and environmentally friendly approach to addressing soil and…
Q: A country that sees most Hepatitis B (HBV) infections in young adults is most likely to have what…
A: The correct answer is D. High endemicity. Hepatitis B virus (HBV) infections that occur…
Q: List the types of junctions found in animal cells, and state a function for each.
A: Animal cells have special parts called cell junctions that help cells adhere together and talk to…
Q: Distinguish between spatial and temporal summation.
A: In neuroscience, summation is an critical concept that clarifies how signals from diverse parts of a…
Q: Determine if each statement is correct or incorrect: 1. Ecosystems with fewer numbers of species…
A: 1. Ecosystems with fewer numbers of species tend to be less stable. Correct.Ecosystems with fewer…
Q: iruses that kill host cells are (a) lysogenic (b) lytic (c) viroids (d) prophages (e) temperate
A: In virology, the relationship between viruses and their host cells can lead to diverse results,…
Q: If you were educating expecting parents on pregnancy, labor and delivery, as well as the first year…
A: Prenatal Development:1. First Trimester (Weeks 1-12):• During the first trimester, the fertilized…
Q: How is the brain involved in the regulation of body temperature?
A: Maintaining homeostasis within the human body requires the imperative physiological work of…
Q: These types of proteins are responsible for all the following events during cell division: movement…
A: Approach to finding a solution to the problem:1. Determine the most important activities that take…
Q: Does fluorescence play a role in photosynthesis?
A: Photosynthesis is the method by which green plants, algae, and a few microorganisms change light…
Q: Which of the following is not an explanation for the lack of Hepatitis C eradication? A) High rate…
A: The fact that hepatitis C strains do not exhibit broad resistance to antiviral drugs is not often…
Q: Which statement is not true of the chytrids? (a) they are simple aquatic fungi (b) they produce…
A: Chytrids are a special bunch of fungi distinguished by their primitive characteristics, which…
Q: E2F is a transcriptiion factor that activates genes for DNA rep- proteins. In addition with RBR,…
A: The capacity of a single cell to isolate and create into a whole organism is known as totipotency.…
Step by step
Solved in 2 steps
- I. The retinoic acid receptor (RAR) is a transcription factor that is similar to steroid hormone receptors. Thesubstance (ligand) that binds to this receptor is retinoicacid. One of the genes whose transcription is activatedby retinoic acid binding to the receptor is myoD. Thediagram that follows shows a schematic view of theRAR proteins produced by genes into which one oftwo different 12-base double-stranded oligonucleotides had been inserted in the ORF. The insertion site(a–m) associated with each mutant protein is indicatedwith the appropriate letter on the polypeptide map.For constructs encoding proteins a–e, oligonucleotide 1(5′ TTAATTAATTAA 3′ read off either strand) wasinserted into the RAR gene. For constructs encoding proteins f–m, oligonucleotide 2 (5′ CCGGCCGGCCGG 3′)was inserted into the gene.NH2 f g h i j k l m COOHa b c d eThe wild-type RAR protein can both bind DNA and activate transcription weakly in the absence of retinoic acid(RA) and strongly in RA’s presence. Each…A scientist compares the promoter regions of two genes. Gene A’s core promoter plus proximal promoter elements encompasses 70bp. Gene B’s core promoter plus proximal promoter elements encompasses 250bp. Which of the scientist’s hypotheses is most likely to be correct? More transcripts will be made from Gene B Transcription of Gene A involves fewer transcription factors Enhancers control Gene B’s transcription Transcription of Gene A is more controlled than transcription of Gene B.The a/a operon is an inducible operon that controls the production of the sugar arabinose. When arabinose is present in a bacterium it binds to the protein AraC, and the complex binds to the initiator site to promote transcription. In this scenario, AraC is a(n). activator inducer repressor operator
- Discuss Concepts In a mutant strain of E. coli, the CAP protein is unable to combine with its target region of the lac operon. How would you expect the mutation to affect transcription when cells of this strain are subjected to the following conditions? Lactose and glucose are both available. Lactose is available but glucose is not. Both lactose and glucose are unavailable.. Let’s say that you have incredible skill and can isolate the white and red patches of tissue from the Drosophila eyes shown in Figure 12-24 in order to isolate mRNA from each tissue preparation. Using your knowledge of DNA techniques from Chapter 10, design an experiment that would allow you to determine whether RNA is transcribed from the white gene in the red tissue or the whitetissue or both. If you need it, you have access to radioactive white-gene DNAThe enormous complexity in initiating eukaryotic gene transcription seems at first glance to be wasteful. What is the most plausible reason for requiring so many different proteins to assemble on a large array of DNA sequences in order to initiate transcription? O The use of large numbers of proteins and regulatory sequences in DNA opens many possibilities for sophisticated combinatorial gene regulation O The need to open chromatin for transcription demands a much larger number of proteins and regulatory sequences in DNA O The use of large numbers of proteins and regulatory sequences in DNA is essential for alternative splicing of hnRNA in eukaryotes O The larger number of eukaryotic genes demands a correspondingly larger transcription apparatus than that of prokaryotes The larger size of eukaryotic cells demands a correspondingly larger transcription apparatus than that of prokaryotes
- The following double-stranded DNA sequence is part of a hypothetical yeast genome which contains a very small gene. Transcription starts at the Transcription Start Site (TSS), proceeds in the direction of the arrow and stops at the end of the Transcription Terminator (green box). 5' 3' TSS CTATAAAAATGCCATGCATTATCTAGATAGTAGGCTCTGAGAAATTTATCTCACT | | | | | | | | | | GATATTTTTACGGTACGTAATAGATCTATCATCCGAGACTCTTTAAATAGAGTGA - 5' PROMOTER TERMINATOR 3' a) Which strand (top or bottom) is the template strand? Explain why. b) What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends. c) What is the sequence of the protein produced from the mRNA? d) If a mutation (an insertion) were found where a T/A (top/bottom) base pair were added immediately after the T/A base pair shown in red, what would be the sequence of the mRNA? What would be the sequence of the protein?a. Very few if any eukaryotic genes contain tractswith more than 25 As or Ts in a row, yet almost alleukaryotic mRNAs have a tract with more than100 As in a row. How is this possible?b. Scientists know the nucleotide sequences that directthe termination of bacterial gene transcription, butthey generally have little idea about the nature ofthe nucleotide sequences that direct transcriptiontermination in eukaryotic cells. Explain the basisof this statement.Each year in the United States, there are over 230,000 newcases of prostate cancer and almost 28,000 deaths. A 3.8-Mbregion on chromosome 8 (8q24), called a gene desert, has genes but contains enhancer sequences that potentiallyconfer significant risks for prostate cancer. One particular enhancerallele, which is known to be associated with an elevated risk forprostate cancer, physically interacts with the promoter region ofthe nearby MYC gene and facilitates its upregulation. Overexpressionof MYC, which encodes a cell-cycle regulatory protein, isobserved in multiple types of cancer (see Chapter 24). The riskallele has a frequency of 49 percent in men of European descentand 81 percent in men of African ancestry. Most of the differentialMYC activity associated with the risk allele occurs during prenataldevelopment, raising the possibility that testing for this alleleearly in life can be used to identify those in the African-Americanpopulation who are at very high risk for prostate…
- Q1. (Shown below is the structure of a Drosophila gene, divided into 10 segments, designated A-J. The gene contains three exons, two introns, a promoter, and a site in I for poly(A) addition. Exon 1 Exon 2 Exon 3 Promoter Intron 1 Intron 2 AATAA A в CDE FG|H a) What segment or segments of the gene will be represented in the initial RNA transcript (primary RNA)? List the appropriate letter or letters. b) What segment or segments of the gene will be found in the completely processed transcript (mature RNA)? c) What segment or segments of the gene in the processed transcript will have additional nucleotides added to them? d) If the segment... . is methylated, this could block the transcription's initiation as RNA polymerase will not be able to bind to this segment.94In the arrested state (7-14 nucleotides) of elongation, ( ) is required to reactivate transcription. 95C. elegans has about 19,000 genes, a significant number of which are organized into operons. Yesorno 96Transcription activator proteins have at least two independently folding domains: 1. DNA binding domain and 2.BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple