QUESTION 15 The researchers Hershey and Chase conducted an experiment where they radioactively labeled the proteins of a T2 phage with 35S. In a separate treatment, they labeled the DNA of a T2 phage with 32p. They allowed the labeled T2 phage to infect E. coli and then agitated the cells so that the phage would fall off of the cells. The cells were then spun down to the bottom of the tubes. When the proteins were labeled, did the researchers see radioactivity in the pelleted cells or the supernatant (liquid on top of pellet)? When the DNA was labeled, did the researchers see radioactivity in the pelleted cells or the supernatant? What conclusion did Hershey and Chase draw from this experiment?
Q: Calculate the hemoglobin concentration of an unknown sample given the following info: concentration…
A: The objective of this question is to calculate the hemoglobin concentration of an unknown sample…
Q: make the statement true in the space provided. 1. The basic meaning of a medical term is defined by…
A: Medical terms are made up of three standard word parts: a prefix, a root word, and a suffix. Prefix…
Q: abel the following graph, which indicates the temperature versus the percent of DNA that is single…
A: The melting temperature of DNA refers to the temperature at which 50% of a given DNA sample has…
Q: What is the CORRECT way to classify the protein below according to its secondary- structure…
A: Peptide bonds are formed when amino acids condense to form protein structures. A protein's…
Q: If 70% of drunk drivers fail to pass a sobriety test (walking a straight line for 5 meters) in 30…
A: The objective of the question is to determine the specificity and sensitivity of a sobriety test…
Q: Please use the following table to compare qualitative (Mendelian) traits and quantitative traits…
A: The external characteristics of an individual are termed as phenotype while representation of the…
Q: Miriam goes on a hunger strike and enters into starvation. This would result in: Group of answer…
A: When an individual goes on a hunger strike and enters into a state of starvation, their body…
Q: For Each of your 3 DNA Templates, Fill out the Following: DNA Template # DNA sequence (copy from the…
A: The process of gene expression involves transcribing DNA into mRNA and then translating mRNA into an…
Q: What drives the rotation of the F1 head (rotor) of ATP synthase? a. proton movement from…
A: The question is asking about the mechanism that drives the rotation of the F1 head, also known as…
Q: QUESTION 1 The relative amounts of each nucleotide base are tabulated below for four different…
A: Virus I:Single-stranded DNAVirus II:Single-stranded RNAVirus III:Double-stranded RNAVirus…
Q: Using the generic structure shown, indicate what the substituents are for the structure of…
A: Substituents in the Finerenone-like Molecule:The chemical structure of a generic molecule. To…
Q: What are the differences between sterilization, disinfection, antisepsis, degermination, and…
A: Sterilization, disinfection, antisepsis, degermination, and sanitization processes are essential for…
Q: Given the allele frequencies below, what would be the expected genotype frequencies in the next…
A: The link between genotype and allele frequencies in a population is described by the Hardy-Weinberg…
Q: Caffeine inhibits feeding activity in tobacco hornworm larvae by inhibiting phosphodiesterase (PDE)…
A: The objective of the question is to understand how caffeine affects the feeding activity of tobacco…
Q: Key: with glucose without glucose
A: The image shows a bar graph with the rate of CO_2 production on the y-axis, measured in parts per…
Q: Suppose part of the amino acid sequence of a protein is N... Gly-Ala - Pro-Arg-Lys ...C. Which of…
A: A frameshift mutation occurs when nucleotides are inserted or deleted from the DNA sequence, causing…
Q: 9 7 13 14 20 20 2 6 3 110 15 16 16 S 11 12 17 18 19 19 22 23 33 15 22 21 21 27 27 28 24 29 30 30 25…
A: Within the study of evolutionary science, one critical aspect is the timing of significant occasions…
Q: A two-month old child was admitted to hospital after failure to thrive. The “boy”, whose external…
A: Congenital adrenal hyperplasia (CAH) is a group of genetic disorders that affect the adrenal glands'…
Q: Malignant tumor cells are characterized by all of the following properties except: A. loss of…
A: The correct answer is: C. reduced dependence on aerobic respiration.Explanation: the other…
Q: Most genetic mutations are deleterious, producing negative effects. True or false?
A: The objective of the question is to determine whether most genetic mutations are harmful or…
Q: A SNV mutation that results in no change in the amino acid sequence is called: A. silent mutation…
A: A mutation is a permanent alteration in the DNA sequence of an organism's genome. DNA, or…
Q: What is biomass? Animal material used as fuel. Plant and animal material used as fuel. Farm animal…
A: Understanding biomass's part in energy generation and the bigger proposals for supportability and…
Q: The chemical structure of food coloring and oil are not provided on their packaging, but based on…
A: The objective of the question is to predict the chemical structure of food coloring and oil based on…
Q: Question 2
A: The objective of the question is to understand the results of an experiment involving mice and two…
Q: Live Culture of Bacillus thuringiensis (Dipel) and B. subtilis (Kodiak) are sold as pesticides. For…
A: Answer is given below Explanation:
Q: Scientific research grant proposal outline on coral reef used for cancer
A: 1. IntroductionBriefly discuss the global burden of cancer and the urgent need for novel…
Q: What tests are useful in the classification of the cause of red cell hemolysis? Question 3…
A: The objective of the question is to identify the tests that are useful in determining the cause of…
Q: What is the 4th part?
A: We will use the same formula and concept provided in the previous concept, that is, .
Q: Draw the mechanism of action of an HIV protease. Label the substrate, the intermediates, and the…
A: HIV protease catalyzes peptide bond hydrolysis of proteins by using water. The enzyme has two…
Q: Which one of these statements about COSEWIC is false? COSEWIC's assessments take into account…
A: COSEWIC, the Committee on the Status of Endangered Wildlife in Canada, is an important part of…
Q: James Smith is a nursing student in her last semester of nursing school. She is working with a…
A: The objective of the question is to determine whether James Smith, a nursing student, violated…
Q: Hemoglobin returning to the lungs will aid in vasodilation in response to: Group of answer choices…
A: Hemoglobin, Oxygen, CO2, and Vasodilation: A Detailed ExplanationHemoglobin's Role:Hemoglobin, the…
Q: Mutation #3 DNA template: 3' TA CGCGCTGCACGATGCAGTAGTACATC 5' mRNA transcript sequence: Amino acid…
A: Mutation #3:DNA template: 3' TA CGCGCTGCACGATGCAGTAGTACATC5'mRNA transcript sequence: 5' AU…
Q: Subject: Environmental Physiology Why is intense physical activity challenging for poikilotherms?
A: Intense physical activity is challenging for poikilotherms due to the impact of environmental…
Q: 3'- AATAAAAAAGGTCCCAAAAAATTAGGGGAGACGGTACATAAA GAGTAGAGTCATAAATTTTAGAGATGCGTA - 5'
A: Following the hints and considering the complementary strand is required:Complementary DNA strand:…
Q: Baking soda + vinegar observation a. Exergonic b. Endergonic c. Feels cold to the touch d. Feels…
A: The question is asking us to identify the correct observation when baking soda is mixed with…
Q: Which of the following does cytosine pair with? Please select all that apply. No partial credit.…
A: Answer: GuanineThe explanation is given below. If you have any further queries or needed extra…
Q: WHAT IS THE BACKGROUND OF THE TITLE SULFAMETHOXAZOLE: BIODEGRADATION, PLANT UPTAKE, AND IMPACT OF…
A: The title 'Sulfamethoxazole: Biodegradation, Plant Uptake, and Impact of Plant on Microbe' refers to…
Q: Which month of the Roman year was originally designated as Sextilis, the second month of summer,…
A: The question is asking for the Roman month that was originally called Sextilis, which was the second…
Q: Compare the food labels of almond milk unsweetened and almond milk sweetened with vanilla. Name two…
A: The objective of the question is to compare the food labels of unsweetened almond milk and vanilla…
Q: Write a set of directions for a red blood cell to deliver oxygen to the brain. Include all the words…
A: The most prevalent form of blood cell, red blood cells, scientifically defined as erythrocytes, are…
Q: Scientific studies have shown that the majority of human genetic differences worldwide exist within…
A: The objective of the question is to determine whether the majority of human genetic differences…
Q: To understand this research, you must be familiar with some basic genetic terminology. Drag the…
A: Genetics is the scientific investigation of genes. Our genes contain information that is transmitted…
Q: In vitro experiments are conducted at pH = 7.4 to simulate physiological conditions. A phosphate…
A: (a) 1.58 (b) 9.48 gramsExplanation:
Q: a 3d structure of protein with acces number of P02008 at uniprot database.
A: The objective of the question is to find the 3D structure of a protein with the access number P02008…
Q: Expository cause effect essay on malaria
A: Malaria, a disease caused by Plasmodium parasites, is a significant global health challenge with…
Q: CIIVII Oent. Clean rolesT Phenotype Frequency Allele Frequency Genotype Frequency Environment:…
A: The allele and genotype frequencies of a popular can be calculated by using the equations of…
Q: Explain the process of digestion in medical terms from the mouth to the anus. Include where each…
A: The process of digestion is a complex series of events that occur from the moment food enters the…
Q: How many siblings are in the second generation? O 10 3
A: A pedigree is a representation of the inheritance of a trait or character or disease from one…
Q: tudent forgot to add GelRed in to the gel mixture when he prepared the Agarose Gel. What will be the…
A: GelRed is a fluorescent nucleic acid stain commonly used in molecular biology laboratories for…
Trending now
This is a popular solution!
Step by step
Solved in 1 steps
- A amp PBR322 4301 fot B Clear Zones Figure 2 The postgraduate student, Demika, inserted her gene of interest into the plasmid, pBR322, before transformation into the competent host cell using heat shock method. After that she cultured the cells on the Ampicillin agar plate before replica plating the colonies onto another Ampicillin (A) and Tetracycline (B) agar plates shown in Figure 2. (1) Referring to the vector pBR322 in Figure 2, which recognition site was cleaved to insert the gene of interest? Based on the observation above, can you identify which colonies are carrying positive mcombinants of BR322? Explain your selection.HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. How did the researchers know that the radioisotopes in the fluid came from outside of the bacterial cells and not from bacteria that had been broken apart by whirling in the blender?HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. After 4 minutes in the blender, what percentage of each isotope was extracellular?
- HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. The extracellular concentration of which isotope increased the most with blending?HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. Before blending what percentage of each isotope. 35S and 32P, was extracellular (outside the bacteria)?HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. Do these results imply that viruses inject DNA or protein into bacteria? Why or why not?
- Question:- There is some recent research on the use of bacteriophages to inhibit pathogenic bacteria as alternative to antibiotics, for example, in poultry. Speculate what are the potential advantages and weaknesses of such phage therapy vs standard antibiotic treatment.In Hershey-Chase experiment, bacteriophages protein coats were tagged with radioactive isotope S-32. These phages were used to infect E. coli cells and the cells were further centrifuged to form pellets. Why was the radioactivity level of S-32 found greater outside the cells compared to the E. coli cell pellets? Explain briefly. If the experiment is repeated in the same manner but this time the phage protein coats are labelled with isotope X and the phage DNA with isotope Y, which isotope’s radioactivity will be found in greater amounts in the E. coli cell pellets after centrifugation? Explain briefly.question: Can you summarize and explain for me what you want to tell in the article below? When I read it myself, I do not understand exactly what is meant by the article. It would be nice if you could highlight the important points. You can use them in a figure or diagram to explain. thank you and hava a nice day :) Article: Interference with Cellular Uptake, Immobilization, and Inactivation of the Virus Outside of the Host Cell Nanomaterials can be synthesized with a high specific surface area of a few hundred square meters per gram. Therefore, dependent on the surface properties, nanomaterials efficiently adsorb biomolecules and form a so-called biomolecular corona. This passive, nontargeted adsorption might be utilized to bind viruses, provided that the selected nanomaterial is relatively biocompatible. Viral surface proteins are often modified by sugar moieties or encompass positively charged amino acid patches that bind to lectins or glycosaminoglycans (GAGs) of heparan sulfate…
- A plaque assay is performed beginning with 1 mL of a solution containing bacteriophages. This solution is serially diluted 4 times by combining 0.1 mL of each sequential dilution with 9.9 mL of liquid medium. Then 0.1 mL of the final dilution is plated in the plaque assay and yields 21 plaques. What is the initial density of bacteriophages in the original 1 mL? Recall that initial phage density = (plaque number/mL) ×× (dilution factor).About the technique of phage display: MOLECULAR BIOLOGY_advanced The Escherichia coli cell infected by the phage codifies for the optimized ligand when the phage DNA integrates in the DNA of the bacteria. Phages are selected if they express on their surface the optimized ligand. One selects Escherichia coli cells that are resistant to the phage infection. More than one optimized ligand can be selected during the panning procedure. The ligand to be selected on the surface of the phage is non-covalently linked to one of the surface proteins.Considering counting rules, calculate the initial titre of the sample viral stock if the following plaques were counted in a plaque assay. Show clear sample calculations. Table 1: Plaque assay counts for lambda phage stock titre enumeration of average concentration (PFU/mL) Total dilution of viral stock 1/13500000 1/135000000 1/135000000 plated Volume diluted viral stock 0.1 0.1 0.1 plated (mL) PFU replicate 1 TNTC 275 25 Calculated concentration (PFU/mL) replicate 1 PFU replicate 2 TNTC 239 23 Calculated concentration (PFU/mL) replicate 2 Average concentration (PFU/mL)