Question 8 Listen In the following questions arrows are used to represent primers. The arrow head is the 3' end of the primer and the other end of the arrow represents the 5' end. Which of the following represents the orientation of primers in a PCR reaction. (The DNA to be amplified is between the arrows) a) b) ↑ c) ↑ ↑
Q: answer only question g
A: Step 1:The anticodon sequence will be…
Q: Muhammad ibnu Abdillah, the traditional founder of Islam, recognized all of the following religious…
A: The question is asking about the religious texts that Muhammad ibnu Abdillah, the founder of Islam,…
Q: Which of the following mutations cannot be inherited by a person's biological children? A mutation…
A: The objective of the question is to identify which type of mutation cannot be passed on to a…
Q: CRISPR is a powerful gene editing tool because a. the programmable enzyme (Cas9) can find an exact…
A: CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) technology has revolutionized the…
Q: There are thousands of children born every year with genitalia structures that are nol fully male or…
A: The objective of this question is to understand the biological reasons behind the occurrence of a…
Q: Why the answer is 0.60. please explain
A: 1. **Graph Interpretation**: - The graph serves as a visual representation of the changes in the…
Q: What is the consequence of an error that is not corrected during DNA replication? Choose one: It…
A: The question is asking about the consequences of an uncorrected error during the process of DNA…
Q: According to current ideas about the DNA genetic code, which one of the following statements is…
A: The genetic code is the set of rules by which information encoded within genetic material (DNA or…
Q: Stark law (Physician Self-Referral Law) Summarize the law or regulation above. Describe the entity…
A: Here's a detailed breakdown of how I approached solving the questions regarding Stark Law, including…
Q: What is the procedure of enzyme formation in our body ? Explain it by drawing.
A: Enzymes are extraordinary chemicals that speed up responses in living things. They are critical for…
Q: A nurse asks, "What is the difference between alcoholic hepatitis and alcoholic cirrhosis?"
A: Hepatitis is defined as a disease whereby the liver is inflamed that can be brought on by many…
Q: Muhammad ibnu Abdillah, the traditional founder of Islam, recognized all of the following religious…
A: The question is asking which of the listed religious texts was not recognized as sacred by Muhammad…
Q: Determination of Creatinine in Serum and Urine Experiment; Question: Why are using this…
A: The assurance of creatinine levels in serum and urine is an basic diagnostic device in clinical…
Q: (please type answer fast).
A: The objective of this question is to calculate the pH of a buffer solution after the addition of a…
Q: GQ11
A: The objective of the question is to hypothesize how changes in the Mc1r protein's amino acid…
Q: Why does hepatitis D only occur in patients with hepatitis B?
A: 1. Dependence on HBV for Replication: Hepatitis D virus (HDV) is a defective RNA virus that lacks…
Q: Phytoremediation is the utilization of plants in the clean up of a polluted area. In a maximum of…
A:
Q: GQ6
A: Approach to solving the question:Comprehending the variances in hair, skin, and eye color is…
Q: Theophrastus of Lesbos, Aristotle’s successor as head of the Lyceum, improved upon Aristotle’s…
A: Monocotyledons (monocots) are flowering plants with a single embryonic seed leaf (cotyledon). They…
Q: SIM (Indole): 1. Explain the incubation conditions 2. Explain the reagents being added 3. Explain…
A: The topic at hand includes a particular microbiological test known as the SIM test, which is…
Q: I have a vial of F2 offspring resulting from a two-generation cross between true-breeding wildtype…
A: b) Pink body color females:Expected number = Total number of flies * Probability of being pink= 120…
Q: Are there any major differences between new world monkey skulls and strepsirrhines skulls? Take into…
A: Approach to Solving the Question:To comprehensively address the question, it's important to approach…
Q: What will be the intermediate formed during the following reaction: + H2O, H -[ میں OH میں مه مهة OH…
A: Approach to solving the question: Detailed explanation:Protonation of alkenes yields carbocations…
Q: What are noticeable characteristics of the Aye Aye and how do their skelatons detail their…
A: The Aye-aye (Daubentonia madagascariensis) is a distinctive and unique primate indigenous to…
Q: Genetics Q6
A: The question is asking where a tRNA molecule carrying the first methionine (MET) would be located in…
Q: which of the following do researchers not need to use during vector cloning? a. a plasmid containing…
A: Certainly! Let's delve deeper into each option:a. Plasmid containing selectable marker genes: When…
Q: Are there any treatments for Jacobsen Syndrome? What are the possible health outcomes for a person…
A: Jacobsen Syndrome, also known as 11q deletion disorder, is a rare genetic disorder that results from…
Q: Genetics Q9
A: The question is asking us to identify the correct definition of a plasmid from the given options.
Q: A country that sees most Hepatitis B (HBV) infections in young adults is most likely to have what…
A: The correct answer is D. High endemicity. Hepatitis B virus (HBV) infections that occur…
Q: Anaerobic respiration requires great stores of glycogen requires extensive capillaries for oxygen…
A: The question is asking about the requirements and role of anaerobic respiration in human energy…
Q: Which subtype of lung cancer is most directly linked with cigarette smoking? A) Adenocarcinoma B)…
A: Answer well explained above
Q: GQ15
A: The objective of this question is to explain how not all mutations are harmful, using the example of…
Q: A negative result with MPO stain would be seen with what cell type? Question 5 options:…
A: The objective of the question is to identify the cell type that would show a negative result with…
Q: MAKE A GRAPH FOR ME ON GRAPH PAPER CALL IT ENZYMES VS RATE OF REACTION USING TABLE BELOW GRAPH…
A: Please give me helpful rating if you are satisfied with the graph.
Q: Genetics Q5
A: The objective of the question is to understand the effectiveness of gene therapy in treating genetic…
Q: You cross two wildtype (short-tailed) chipmunks, and collect a male offspring with a particularly…
A: Approach to solving the question: Detailed explanation: Examples:aApproach to finding a solution to…
Q: Question 4 1 pts What terms best describes the ability of muscle to recover from contraction? ○…
A: The objective of the question is to identify the term that best describes the ability of a muscle to…
Q: Phytoremediation is the utilization of plants in the clean up of a polluted area. Are Indian…
A: Approach to solving the question: Detailed explanation: Examples: Key references: Biology
Q: After watching video that’s linked please answer the questions! Thank you!…
A: In diabetes, the body faces difficulties in regulating blood sugar levels due to problems with…
Q: Calculate the 2 possible values of x in this equation: x2 – 16x + 48 = 0, either by using the…
A: The objective of this question is to find the roots of the quadratic equation x^2 – 16x + 48 = 0.…
Q: -Centromere D D Ø ☹ A B ℗ ℗ D E C
A: The objective of the question is to determine the chromosomal condition of a daughter nucleus at the…
Q: There are several instances which challenge the “one gene, one polypeptide” hypothesis. Describe TWO…
A: 1. Alternative splicing is a process that allows for the synthesis of numerous protein isoforms from…
Q: If 80% of drunk drivers fail to pass a sobriety test (walking a straight line for 5 meters) in 60…
A: The objective of the question is to determine the specificity and sensitivity of a sobriety test…
Q: Explore the differences between positive inducible, positive repressible, negative inducible, and…
A: Positive Inducible Regulation:- In positive inducible regulation, the binding of the regulatory…
Q: In Aristotle’s scala naturae, the entoma (insects, chelicerates, and other non-crustacean…
A: In the historical concept of the scala naturae, also known as the Great Chain of Being, Aristotle…
Q: * pilot Spring 2024 Introduction to Cell Biolog... Home Content Communication Dropbox Section 7…
A: Approach to solving the question:1. Identify the mechanism of action of tricyclic antidepressants…
Q: wwwwwwww wwwwwwwww If the progeny of the cross aaBB x AAbb is testcrossed, and the following…
A: Sure, let's break down the explanation step by step:1. Identify Recombinant and Parental Genotypes:…
Q: What group of tests can be done to diagnose chronic myelocytic leukemia? Question 6 options:…
A: The objective of the question is to identify the correct group of tests that can be used to diagnose…
Q: 18
A: DNA sequence 5'ACCTGTGCAATATACGGCCAT3'3'TGGACACGTTATATGCCGGTA5'mRNA5' ACCUGUGCAAUAUACGGCCAU 3'Amino…
Q: Frank is learning about digestion. He asks, "Why doesn't the pepsin from the stomach digest the…
A: Together, these mechanisms ensure that the digestive enzymes, including pepsin, break down food…
Genetics Q8
Step by step
Solved in 2 steps with 1 images
- Question 36 Using Sanger sequencing, starting from the sequencing primer, what is the sequence of the DNA sample ? Question 36 options: G T A C C C G A A A T C A G G A A G G A C T A A A G C C C A T G G T A C C C G A A T T C A G G A A G C A C T A A A G C C C A T G Question 25 What is a major drawback of performing genome editing with site-specific endonucleases over RNA-guided endonucleases? Question 25 options: difficulty in transformation Necessity of protein cargo to facilitate the editing the need to genetically engineer a new endonuclease for each target sequence. Specificity is not achieved Question 23 What is not true for Sequence tagged site (STS) markers: Question 23 options: cannot be mapped by fluorescence in situ…QUESTION 6 To verify the is indeed inside your plasmid, you'd like to do a colony PCR. But you need primers for your reaction. Which of the following primer pairs would probably work for verifying your insert is actually present in the plasmid? 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGG TTTACTATCCTGATGAAATTTT (Very long, but a bunch of nucleotides her e).... TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTGATGAGGATGACTC TGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm= 59.8 O A. Reverse: 5' CAA ATT ACA TTA CAC ATA A 3' Tm= 47.4 Forward: 5' ATG TTT ATT TTC TTA TTA TTT 3' Tm= 47.1 C O B. Reverse: 5' TAT GTG TAA TGT AAT TTG ACA CCC 3' Tm3 58.4 Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm3 59.8 OC. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG 3' Tm: 59.4 Forward: 5' GGT CAC TAC CAC TAG TGA GAG 3' 59.4 C O D. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG…QUESTION 17 OL NEere interested in generating a PCR amplicon including the bracketed sequence below. Which of the following sequences would be canen hybridizing (annealing) with the target AND would also serve to generate a copy of the bracketed region of interest? 5'-AATCGT[AGCAGCAGCAGTGGCT]A AGCT-3 3' -TTAGCA[TC GTC GTC GTC ACC G A] TTCG A - 5' 3-TTAGC-S S-AATCG-3 OSAAGCT-3 5-AGCTT-3 5-GCTAA-3 5-TCGAA-3 QUESTION 18 Vhich of the following is/are true regarding the enzvme PRIMASE? Save and Submit to save and submit. Click Save All Answers to save all answers.
- QUESTION 1 You want to perform PCR on the CDNA of the spike gene from a SARS CoV-2 sample so that you can sequence it. Based on the sequence below, which of the following primer pairs would probably work for PCR of this gene? Spike gene Sequence: 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGGTT TACTATCCTGATGAAATTTT. .. (it's really long so didn't post the whole thing.).TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTG ATGAGGATGACTCTGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC - 3' (Tm = 60.5 °C in a standard qPCR mix) Reverse Primer: 5' GGG TGT CAA ATT ACA TTA CAC ATA - 3' (Tm= 59.6 °C in a standard QPCR mix) Forward Primer: 5'- ATG TTT ATT TTC TTA TTA TT -3' (Tm=D 47.2 °C in a standard qPCR mix) Reverse Primer: 5'- GCA AGA ACC ACA AGA GCA TGC ACC -3' (Tm= 68 °C in a standard qPCR mix) Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC -3'…QUESTION 1 Questions 1-5. Please fill in the blank below with the corresponding structures indicated below in the diagram: Please ignore the fact that the fragments are colored blue and green. The coloration has no significance to this question. Also, please don't forget to answer question 61 1. Leading strand= 2. Lagging strand= 3. A single Okazaki fragment= 4. 3' end of fragment labeled "H"= 5. Replication fork= H E G 6. How many primers are required to replicate all of the DNA fragments in the above diagram (include both lagging and leading strand)?=Question 6-10: Choose the enzyme and match it to its function. Bubble the correct letter on the Zipgrade answer sheet. Primase DNA Polymerase Ligase Helicase Topoisomerase/gyrase а. b. с. d. е. 6. This enzyme starts the replication process with a small strand of RNA that is later replaced. 7. This enzyme removes primer and starts adding DNA. 8. This enzyme joins Okazaki Fragments. 9. This enzyme unwinds the original strands of DNA so they can act as templates. 10. This enzyme prevents supercoiling .
- QUESTION 1 In this gel, PCR is performed using primers outside of the repeat area anf the product is then run on a gel. Which of these alleles would be the lowest band and which would be the highest band when run on a gel (remember how electrophoresis works!!) ALLELES #1 -CACACACACACACACACACACACACACACA -CACACACACACACACACACACACACACACACACA # 2 # 3 -CACACACACACACACACACACACACACACACACACA- GENOTYPES 1 2 3 4 5 6. O 1 is lowest band and 3 is the highest band O 3 is lowest band and 1 is the highest band O 1 is the lowest band and 2 is the highest bandQUESTION 2 The SARS-COV-2 pandemic resulted in the desire to design ELISA assays to either detect antibodies against SARS-CoV-2 protein (previous infection), or detect viral protein (current infection). You plan to express the mutant spike protein variant using the plasmid pictured below as your template. Here's the sequence you want to put in its place: https://www.ncbi.nlm.nih.gov/nuccore/AY429073.1?report=fasta, this is the DNA sequence you're going to buy as a gene block! But you need to add a couple things to it first so it'll get into the plasmid. To do so, you're going to need to remove the current insert (represented by the yellow arrow beginning at position 833-4867). Question: What restriction sites are you going to add at the ends of the gene? Answer can be in nucleotides or the enzyme name. For the first blank fill in the site name/sequence you'd add at the beginning of the gene (5' / C-terminus end) and for the second blank fill in the sequence/site name you'd add at the…QUESTION 22 During the search for the Cystic Fibrosis (CF) gene the investigators used various criteria to conclude that they had arrived at a segment that represented a gene. Which of the properties below was among the criteria used by the investigators? O A. the presence of sequence palindromes O B. gene-specific restriction maps O C. interspecies sequence conservation O D. polyadenylation signals O E. the presence of AT-rich islands QUESTION 23 A feature common to activation of the myc oncogene by both the Avian Leukosis virus and the chromosomal 8:14 translocation is: O A. loss of the 1st myc exon (E1); initiation of transcription from a start site within the myc intron O B. Initiation of transcription from a strong promoter upstream from the first myc exon (E1) O C.A fusion transcript between an active upstream gene and the three myc exons O D.A DNA deletion that eliminates the transcriptional termination signal from an active upstream gene. O E. Recombination between the myc…
- Question 5 Review DNA sequencing and cloning tools. Which of these is not used to make a recombinant DNA? O restriction enzymes to create sticky ends of a plasmid O fragment from a different DNA cut by the same restriction enzyme O DNA ligase seals the recombinant DNA O denaturationQUESTION 23 Below is a plasmid with restriction sites for BamHI and EcoRI. Several restriction digests were done using these two enzymes either alone or in combination. Which lane shows the fragments produced when the plasmid was incubated with both EcoRI and BamH1? Plasmid Bam HI. Bam HI OI O O 2 Kb O O || ||| IV V 4 Kb 6 Kb PGEN101 (20 Kb) Eco RI Bam HI 8 kb Base pairs 20 Kb 11 Kb 8 Kb 6 Kb 3 Kb I Gel lanes. || III IV VQUESTION 1 The table below shows the results from looking at the diagnostic accuracy of a new rapid antigen test for COVID-19 in 100000 patients, compared to the reference standard RT-PCR test. The rows of the table represent the test result and the columns the true disease status (as confirmed by RT-PCR). COVID-19 Positive COVID-19 Negative Antigen Test Positive Antigen Test Negative 424 795 8216 90565 Calculate the SENSITIVITY of this new rapid antigen test as percentage with 3 decimal places. (Assume that the RT-PCR reference has a 100% Sensitivity and 100% Specificity.)