"VDAATFKQANDNG" is the sequence of an a helix. Which of the following interactions is probable? (. denotes a H-bond) N...A F...V V...A Q...A
Q: 3b) Both a-helical 2° structure and b-pleated sheet 2° structure result from the same type of…
A: Proteins are the unbranched polymer of amino acids. They have four different level of structural…
Q: Even peptides with large nonpolar regions may contain alpha helices stabilized by hydrogen bonding…
A: polypeptides form either alpha helical structure or beta sheets stabilized by hydrogen bond.
Q: Which of the following amino acid changes can result from a single base-pair substitution? Explain…
A: Mutations are alterations in the DNA sequence of an organism. Small changes, such as adding or…
Q: You want to mutate a Trp residue which is located in the interior of a protein structure. Which of…
A: Amino acids are the monomers that are bonded by peptide bonds to make polypeptide chains.
Q: how would I Draw a simplified diagram of the phosphodiester linkage between two nucleotides,…
A: Nucleic acids such as DNA and RNA, contain genetic information and information about protein…
Q: What do you mean by double helix ? Explain with the help of a diagram.
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Long-range interactions between residues on a single polypeptide chain are classified as quaternary…
A: Proteins are the linear chain of amino acids attached together via peptide bonds. Proteins are…
Q: 1. a. What is the role of these bond of the polypeptide in determining the secondary structure of…
A: Protein is made up of polypeptides. Polypeptides are the polymer of amino acids and these amino…
Q: Draw the structure of the dipeptide Thr-Cys at pH7. Clearly indicate the following: the amino…
A: A dipeptide is formed between two amino acid residues in which an amino group of one amino acid is…
Q: . Vwhat do you think holds together the various secondary structural elements in a Stickular…
A: These questions are about interactions in amino acids.
Q: SYNZIPS are a-helices that can be used in synthetic biology to create coiled-coil interactions…
A: Secondary structure of protein describes the special arrangement of its main chain atoms, without…
Q: A particular DNA sequence encodes for MRNA that then encodes for the amino acid glutamate in a…
A: In translation, the newly formed mRNA is decoded in a ribosome. The ribosomes facilitate decoding by…
Q: Within a protein, certain amino acids are positively charged (e.g.,lysine and arginine), some are…
A: DNA or the deoxyribonucleic is the defined genetic material and it is made up of a base, deoxyribose…
Q: A comparison of the aligned amino acid sequences of two proteins each consisting of 150 amino acids…
A: In the given case both the proteins can be of related population so, the proteins can be related by…
Q: β-mercaptoethanol ____, and urea _____ disrupt the interactions involved in formation of α-helices.…
A: DNA stands for deoxyribonucleic acid. It is the genetic material of the organisms that transfer from…
Q: You have discovered a new protein, one whosesequence has about 25% homology with ribonuclease A. How…
A: It is given that a new protein is discovered; whose sequence has about 25% homology with the…
Q: In the amino acid sequence below, the amino acid residue in red was shown to be essential to the…
A: Peptides or proteins are composed of twenty standard amino acids. These standard amino acids differ…
Q: What is the most consistently (i.e. found in every case) energetically unfavorable aspect of protein…
A: People have developed molecular dynamics simulations of the basic atomic forces that determine a…
Q: Some point mutations cause a change in amino acid sequence but nonetheless may have little to no…
A: option f is correct . This is because each group of amino acid belong to same category means . If…
Q: if two polypeptide chains are interacting as alpha helices with the following amino profiles: A:…
A: if two polypeptide chains are interacting as alpha helices with the following amino profiles: A:…
Q: What kind of weak bonds hold the two strands together? How is that weak bond drawn?
A: Answer - Hydrogen bonds (-H) is a weak bond that holds two strands together. Explanation - Each…
Q: What are the Characteristics Binding Site?
A: Binding sites are present in all the macromolecules such as proteins. This binding is done with…
Q: Helices can be described by the notation nm,where n is the number of residues per helical turn and m…
A: Proteins are a type of macromolecule that have a variety of roles in biological processes. It is…
Q: What could be the implications if there is a misfolding in the protein structure?
A: Protein folding is a physical process. In this process, the native polypeptide chain folds into an…
Q: VDAATFKQANDNG” is the sequence of an α helix. Which of the following interactions is probable? (...…
A: The alpha helix structure is a secondary structure found in folded proteins. The alpha helix in…
Q: f an Arg residue in a protein was replaced with either Lys or Glu amino acid, which substitution…
A: Proteins are large biomolecules that compose structural and motor elements of a cell, and also as…
Q: Explain the single-polypeptide chain folds ?
A: Proteins contains one or a lot of molecules of polypeptides. Proteins square measure necessary as…
Q: What is the primary reason the a-helix conformation in polypeptides such a stable form? A. The…
A: The secondary structure of protein determines the local spatial arrangement of the amino acids in…
Q: How do covalent bonds differ from hydrogen bonds? Define base complementarity (refer to…
A: The stable attraction between atom, molecules or ions are called chemical bonds. Molecules and…
Q: In what naturally occurring nucleic acids would you expectto find A-form helices, B-form helices,…
A: Nucleic acid is the genomic component of every cell, which possess entire information of the cell…
Q: why do you think this is? In your explanation, you should describe the specific molecular…
A: 1. Proline is rarely found in beta sheets or alpha helices this is because proline is totally…
Q: Which of the following peptides is most likely to form an a-helix? ETAEKAFKQYANDN GLLKQSTQCLEVKT…
A: Most of the alpha-helix are transmembrane proteins
Q: 57. Renaturation may be expected in the denatured proteins of which of the following cases? A.…
A: In molecular biology, renaturation refers to the restoration of a protein or nucleic acid (such as…
Q: Consider the following amino acid sequence :a)Where might bends or βturns occur? b)Where might…
A: Polypeptides are polymers of amino acids, in which consecutive amino acids are linked by peptide…
Q: c. Label each amino acid as polar, non-polar, or electrically charged d. Label the N-terminus and…
A: Introduction Amino acids are the building blocks that adjoin together by a peptide bond to form a…
Q: List some of the possible combinations of α-helices and βsheets in supersecondary structures.
A: The helix and the pleated sheet are the two most important secondary structures. Hydrogen bonds…
Q: transmembrane portion of an alpha helix?
A: The alpha-helix is a coiled structure made up of proteins which consists of single chain of amino…
Q: A protein has a clearly defined hydrophobic core; however there is the residue glutamine within the…
A: The correct option is (a) Hydrophobic interactions
Q: Can a mutation change a protein’s tertiary structure without changing its primary structure? Explain…
A: Every function in living beings depends on proteins. There are different types of proteins and each…
Q: Draw the structure of STVWY at pH 13. Connect with an arrow the C=O of the N- terminal residue to…
A: The given peptide is composed of five residues. The name of the fiver residues from N-terminal to…
Q: 3. Which best describes the contribution of tertiary (3’) structure of to the native conformation of…
A: Protein tertiary structure is the three-dimensional shape of a protein. The tertiary structure will…
Q: Suppose that a polypeptide contained one aspartate (Asp) residue and one arginine (Arg) residue and…
A: Biomolecules are organic molecules made up of mainly carbon and hydrogen, but other elements are…
Q: Which of these peptides is the most hydrophobic? A. KFYV B. ERSC C. PIMF
A: Proteins are modified polypeptide chains. These chains are made up of 10 or more amino acids linked…
Q: Which of the following peptides will likely adopt an alpha helix? H-I-R-E-F A-D-L-E-E A-D-E-L-E…
A: The most common types of secondary structure are alpha-helix and beta-pleated sheets. The…
Q: Two peptides have almost the exact same primary structure, except that one has about 10 fewer amino…
A: Proteins or peptides have significant roles in our bodies. They are the building blocks of the body.…
Q: If a quaternary (4°) protein structure has six N-terminus. How many total subunits does it have?
A: Proteins are the most important macromolrcules in the body. The proteins has definitely structural…
Q: 2. Of the two sequences, which is more likely to have helical structure. Explain. a)…
A: The amino acids are the protein structure alphabet; they can be arranged to create an almost…
Step by step
Solved in 3 steps
- (a) NMR measurements have shown that poly- L -lysine is a random coil at pH 7 but becomes a helix as the pH is raised above 10. Account for this pHdependent conformational transition. (b) Predict the pH dependence of the helix–coil transition of poly- L - glutamateBelow is the primary structure of a protein. A R 1 I I H H || O H 1 Psi bond [Select] Phi bond [Select] N-terminus [Select] B C D H O I || C-terminus [Select] NC-C-N-C-C-N-C-C-N-C-C-N-C-C - N... I 1 H H I R R H I 11 O HO I || R R I I H a. For each part of the question, select the letter associated the with appropriate component of the structure. Peptide bond [Select] I H U MO b. Which letter represents a bond without 360-degree rotation? [Select] H |Long-range interactions between residues on a single polypeptide chain are classified as quaternary structures. On the other hand, interactions between residues on separate polypeptide chains are classified as tertiary structures. O Both statements are correct O The first statement is correct while the second statement is incorrect O Both statements are incorrect O The first statement is incorrect while the second statement is correct
- Show below is a polypeptide comprised of 3 α-helices and 5 β-sheets joined by randomcoil. Characterizetheforces that stabilize the tertiarystructure and draw the interacting side chains ofd) Cys Cysrotein which How many: (a) Nitrogenous bases code for the protein? (b) Anticodons code for the protein? (c) Genes code for the protein? Identify the processes labelled 2 and 3. Indicate where process 2 takes place in a cell. Describe the process taking place at 1. Identify molecules A and B respectively. Tabulato TWO1. Draw the tripeptide: Val-Leu-Met at pH 7 with the N-terminus to the left and C-terminus to the right. On your drawing, do the following: a. Draw a triangle around the alpha carbons. b. Draw a box around the R-groups. c. Circle the atoms capable of hydrogen bonding. d. Highlight the peptide bond. Ma voy bludy 2. What specific atoms in your tripeptide (above) can participate in hydrogen bonding?
- A protein has been sequenced after cleavage of disulfide bonds. The protein is known to contain 3 Cys residues, located as shown below. Only one of the Cys has a free –SH group and the other two are involved in an -S-s- bond.Chicken egg contains a lot of proteins which supports the growth and development of the chicken embryo. The chicken egg was placed on high heat (100°C) until it forms a solid structure. Which of the following statements is correct about the given scenario? O The increase in temperature may interfere intermolecular forces of attraction that stabilizes the native conformation. O Structural and functional characteristics of proteins remain intact even temperature was increased to boiling O Extreme temperature conditions may result to irreversible denaturation due to destruction of primary. secondary, tertiary, and quaternary structures By decreasing the temperature, the egg embryo can still develop, and grow to become a chicken because renaturation may take place.(a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5' GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5' GTCCCATACGTAGCCGTAGGACATGTACCG 3' Y 5' CGGTACATGTCCTACGGCTACAATGCGATC 3' Z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3' I and 21
- CH3 НО CH3 describe a biochemical function of the structure shown above .......Proline is known as a beta sheet and alpha helix "breaker ," therefore proline is rarely found in beta sheets or alpha helices. why do you think this is? In your explanation, you should describe the specific molecular interactions necessary for the formation of alpha-helices and beta-sheets. Please be as specific as possible.. Assume that some protein molecule, in its folded native state, has one favored conformation. But, when it is denatured, it becomes a "random coil," with many possible conformations. (a) What must be the sign of AS for the change: native → denatured? (b) How will the contribution of AS for native → denatured affect the favorability of the process? What apparent requirement does this impose on AH if proteins are to be stable structures?