Q: Adding glucose to the plasma mimics the process of - secretion O reabsorption dialysis O filtration
A: ANSWER;- Filtration Explain;- filtration is the process in which solid particles in a fluid or…
Q: Essay on Circulatory system
A: Introduction The heart, blood vessels, and blood are all part of the blood circulatory system, which…
Q: Explain the figures below in detail, this is about baroreceptors Baroreflex Disturbance Response 1.0…
A: Baroreceptors They are mechanoreceptors found in blood arteries around the heart that detect the…
Q: An eukaryotic chromosome has several origins of replication. How many origins of replication are…
A: Introduction :- The levels of packaging from raw DNA molecules to the chromosomal structures seen…
Q: How do Restriction Enzymes like EcoRI work?
A: Restriction endonucleases are the enzymes which is used to cut particular region of DNA . They make…
Q: What is the role of 16S rRNA during initiation of translation?
A: Introduction :- Eukaryotic initiation factors (eIFs) assemble initiator tRNA, 40S, and 60S ribosomal…
Q: Substance that moves the electrical field solely depends on the speed of the substance in the…
A: 1. Substance that moves the electrical field solely depends on the speed of the substance in the…
Q: Generally, one single mutation is enough to cause cancer. [Select] Cancer-causing mutations cause…
A: When the genes that control cell division are disrupted, cancer cells are produced. Carcinogenesis…
Q: How many exons has the CFTR gene?
A: Introduction :- The CFTR gene encodes a membrane protein and chloride channel in vertebrates called…
Q: What ions are removed from the uremic plasma? Mark all that apply Na+ K+ CI- Ca+2
A: Due to inadequate excretory, regulatory, and endocrine function of the kidneys results in uremic…
Q: The receptors have been found on ganglia of the
A: Muscarinic receptors bind to the neurotransmitter acetylcholine, converting this identification into…
Q: Calculate for the water activity of the soy sauce in 80.3% ERH. Suppose the soy sauce is subjected…
A: Water activity is measure of energy status of water in a system.If more energy then microbial…
Q: Now, solve the following problems involving radiation: 1. Why is 1 mGy of alpha radiation considered…
A: Alpha particles is double ionized helium He++ ion. The beta particles is electron like elements.…
Q: The current estimate is that mammalian B cells are capable of producing 1,010 different…
A: Immunoglobulins are composed of four polypeptide chains out of which two are heavy chains and two…
Q: It has been suggested from study of cell cultures in a lab setting (not demonstrated in living…
A: The virus consist of mostly RNA when the RNA is introduced inside the host cell, so to infect the…
Q: The following items are usually found in non-natural or synthetic cosmetic ingredients. Define each…
A: Antibiotics are antibiotics that are used to treat and prevent infections caused by bacteria.…
Q: How do plants and animals use their special adaptation to survive in their own ecosystem?Give an…
A: Eukaryotes are the organism which comprises of true nucleus and Membrane bound organelles . Such…
Q: Explain why aspartate residues play an important role on the active site of DNA polymerase.
A: Before getting into the answer let's understand what is aspartic acid. Aspartic acid (or aspartate)…
Q: VSV-GFP- SARS-CoV VSV-GFP- SARS-CoV-2 U Plaque Day 3 (duplicate) 1.51 1.0- 0.5- 0.0 VSV-GFP-…
A: In virology, spike protein or peplomer protein is the type of protein complex with the large…
Q: Interpret the level of gene expression of the lac operon, as well as the status of the lac repressor…
A: In inducible system, the end product inactivates the active repressor and the whole system turns on.…
Q: The definition of "lineage" is:
A: Lineage refers to a group of individuals that have descended from a common ancestor. They descend in…
Q: The lac operon produces: (choose the best answer) O A single mRNA molecule O A single protein O A…
A: Transcription: It is the process through which the enzyme RNA Polymerase transfers information from…
Q: Match the organisms with their descriptions. ___ echinoderms a. stinging cells in tentacles ___…
A: The cell is that the most basic structural and purposeful unit of life. It performs a range of…
Q: During a crossover event, more nonrecombinant than recombinant gametes will be produced. O True O…
A: Introduction Crossing over refers to the exchange of DNA between paired homologous chromosomes that…
Q: You are studying the process of oxidative phosphorylation in the lab. You isolate several…
A: Mitochondria is also known as the powerhouse of the cell.
Q: Why is the bicep reflex so hard to demonstrate? Does it have anything to do with our nervous system?
A: The biceps is a muscle present on the front part of the upper arm. The biceps includes a “short…
Q: The normal flow of electrons through the electron transport chain is blocked by sodium azide. Which…
A: The citric acid cycle and electron transport chain is the aerobic stages of cellular respiration.
Q: 1. Base on the graph below, why might the sex ratio of bird species in the figure change from as…
A: Juvenile involving young people who are not yet adults . In the birds the frequency change from…
Q: 1. What might be a disadvantage to temperature-dependent sex determination?
A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…
Q: Choose 1 biotechnology product in the field of medicine. Provide a 1-2 minute monologue about this…
A: The relationship between science and health services is that science creates medicine and methods of…
Q: ONCO 5
A: The female gametes generated by the ovary, are referred to as ova (or eggs). The initial stage in…
Q: The proteins work together to cause the release of the transcription factor that is bound by the…
A: Answer is D p53
Q: The trp operon, found in E. coli, is a group of genes that encode biosynthetic enzymes for the amino…
A: When tryptophan levels are low tryptophan operon is induced to transcribe structural genes so that…
Q: Which 2 systems work together to bring in and deliver oxygen to the cells and get rid of carbon…
A: Introduction :- The circulatory system transports wastes and supplies oxygen and nutrients to cells.…
Q: Decreased osmolarity in the renal interstitium and vasa recta results in - (Mark Two) decreased…
A: The regulation of water concentration in the body is mediated by a hormone called vasoppresin or ADH…
Q: If an antisense RNA is designed to silence the following mRNA sequence, which of the following…
A: mRNA sequence:-5' UAGGACUAUUAAGGUACACCCAUU 3' to silence this sequence the antisense RNA should be…
Q: Helping tags: Biology, microbiology, Vibrio spp. It's a common practice in some countries to eat…
A: Oyster refers to a group of salt-water bivalve molluscs that dwell in marine or brackish…
Q: Describe the enzymatic reaction of the protein epidermal growth factor. Include the specific…
A: Epidermal growth factor is a protein, involved in cell cell proliferation and differentiation, by…
Q: What are the principle and basic concepts of NEGATIVE staining?
A: Introduction Staining is a technique for enhancing contrast in material, usually on a microscopic…
Q: Which of the following is not a fossil fuel? a. natural gas b. coal c. wood d. petroleum
A: Introduction :- Plants and animals decompose to produce fossil fuels. These fuels, which can be…
Q: Explain how the activities of endocrine glands are regulated. 250 word count in own words thank you
A: Introduction :- The endocrine system is made up of hormone-producing glands. Hormones are the…
Q: acts both centrally and peripherally. Its general actions last about 4 hours, except when placed…
A: Option A is not correct because scopolamine is one of the most effective antimotion sickness drugs…
Q: The classification of living organisms is a job that cannot be done by one individual and can never…
A: classification of organism -Each organism is different from all others to a lesser or greater…
Q: Which of the following is true of Generalized transduction? O creates defective virions that are…
A: Generalized Transduction: The bacteriophage first infects the donor cells and begins the lytic…
Q: What are the principle and basic concepts of SHAEFFER-FULTON METHOD? (please explain it thoroughly…
A: Answer
Q: On what chromosome is the CFTR gene located?
A: CFTR stands for Cystic Fibrosis Transmembrane Conductance Regulator. CFTR gene produces CFTR…
Q: Two homologous chromosomes in ES cells are depicted below with the portion of your gene of interest…
A: CRISPR/Cas9 creates specific double-stranded breaks at the target locus that trigger DNA repair…
Q: give an example of creation myths in the philippines stories
A: Introduction Philippine mythology is a collection of stories and epics derived from and incorporated…
Q: s it possible to stop animal testing?
A: The use of animals other than humans in experiments for study and research is referred to as animal…
Q: The 20th century would witness the new anti-biotic revolution that would save millions of lives.…
A: INTRODUCTION Antibiotics are drugs that are used to treat bacterial illnesses in humans and animals.…
Which form of flavin adenine dinucleotide is the "reduced" form, FAD or FADH2? Explain
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Draw and label the following RNA tetranucleotide: 5’phosphoryl-A-2’O-methyl-C-U-G-3’-phosphateWhat are the properties of the wild type amino acid, Tyrosine at position 368? Hint: the amino acids are numbered in order starting at the N-terminus.The adenine derivative hypoxanthine can base-pair with adenine. Draw the structure of this base pair.
- Based on the N-terminal amino acid sequence, what is the approximate half-life of the protein after methionine is cleaved off?Three E. coli tRNA molecules with the anticodon sequences CGG, OGG , and UGG are charged with the same amino acid. What is the amino acid ?Lactose permease, a protein of E. coli, is composed of a single polypeptide that is 417 amino acids in length. By convention, the amino acids within a polypeptide are numbered from the aminoterminus to the carboxyl-terminus. Are the following questions about lactose permease true or false? A. Because the 64th amino acid is glycine and the 68th amino acid is aspartic acid, the codon for glycine, 64, is closer to the 3′ end of the mRNA than the codon for aspartic acid, 68. B. The mRNA that encodes lactose permease must be greater than 1241 nucleotides in length.
- List all possible codons present in a ribonucleotide polymer containing U and G in random sequence. Which amino acids are encoded by this RNA?Two possible point mutations are the substitution of lysine for leucine or the substitution of serine for threonine. Which is likely to be more serious and why?Which is the most deleterious type of amino acid substitution? Explain.