Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table. Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-Cys
Q: 4. Peculiarities of hormonal regulation of glycogen metabolism in muscles and liver.
A: The glycogen synthesis mainly occurs in the muscle, and liver, using glucose-6-phosphate. The…
Q: 5. Reciprocal regulation of glycogen phosphorylase and glycogen synthase activity.
A: Enzymes are proteins that aid in the speeding up of chemical reactions. Enzymes bind to substrates,…
Q: The pyruvate dehydrogenase (PDH) complex catalyzes the oxidative decarboxylation of pyruvate to…
A: Pyruvate dehydrogenase (PDH) complex oxidizes pyruvate to acetyl-CoA and carbon dioxide. It takes…
Q: 。. An investigator has a strand of chromosomal DNA whose sequence is shown. She wants to use…
A: PCR or polymerase chain reaction is a lab procedure that amplified fragments of DNA by using a…
Q: Identify two (2) functions of lipids in the body. Explain each function in 2 sentences.
A: Lipids are a very important class of biological molecule. Lipids are a broader class of molecule…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: The DNA contain genes (functional unit) that encode protein molecules. Proteins are the "workhorses"…
Q: Structure and properties of triacylglycerols, their biological role.
A: Triacylglycerols, also known as triglycerides, are made up of three fatty acids that are…
Q: What is the name of this cofactor related to niacin? 0 O-P :0 U -ро OH -CH₂ Н Н OH NH₂ OH Н OH 2+…
A: Niacin is also known as vitamin B3. It is also known as nicotinic acid. It is a water soluble…
Q: Arrange the following in the order they appear in electron transport. a. FAD, coenzyme Q, cytochrome…
A: Electron transport chain is a chain of electron carriers present in the inner mitochondrial…
Q: If a slight deficiency in the Vitamin B1 derivative Thiamine Pyrophosphate (TPP) leads to an…
A: TPP is a cofactor used by many enzymes. TPP helps to cleave bonds near to a carbonyl carbon.
Q: Mechanism of action of electron transport inhibitors. Amital.
A: INTRODUCTION : First of all, there is no electron transport inhibitor called Amital, it is a wrong…
Q: Arrange the following in the order they appear in electron transport. a. FAD, coenzyme Q, cytochrome…
A: Electron transport chain is a series of protein and organic molecules located in the inner membrane…
Q: a) This molecule is produced when what amino acid is transaminated? b) What are the one- and…
A: Amino acids are biomolecules in which an amino group and a carboxyl group are linked to the same…
Q: Is increasing the P; concentration a reasonable way to couple ATP hydrolysis and glucose…
A: It makes sense to relate ATP hydrolysis and glucose phosphorylation by increasing the P…
Q: The structure given below represents what molecule? CHO I H-C-OH I CH₂OH dihydroxyacetone phosphate…
A: A substance called glyceraldehyde occurs naturally in all living things, including people. It is a…
Q: 1. Draw (or insert) the general formula of an amino acid and label the four components. Which one…
A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question for…
Q: 5. We're back in the lab having fun! Our current experiment calls for us to treat our cells with THC…
A: A stock or standard solution is one whose concentration is precisely known. Stock solutions can be…
Q: 4. Which of the following mutations would most likely keep the transitions of T state to R state in…
A: Amino acids are biomolecules that have a carboxyl group, an amino group and a side group linked to…
Q: What is qualitative analysis of lipids? How important qualitative analysis of lipids in the field of…
A: Lipids are one of the 4 major groups of biomacromolecules. Lipids are a set of biomacromolecules…
Q: How similar of an effect would a mutation in pyruvate dehydrogenase have, compared to a mutation in…
A: In glycolysis, a 6-carbon molecule of glucose-6-phosphate is broken down into 3-carbon pyruvate by…
Q: The citric acid cycle is shown. The methyl carbon in acetyl CoA is labeled with C14C14 (shown in…
A: Citric acid cycle - it is also called as Krebs cycle or the TCA cycle (tricarboxylic acid cycle)…
Q: Transcriptional initiation at defined sequences in DNA is required to ensure that the 5' end of the…
A: By forming a DNA-protein complex with a specific DNA binding protein, DNA regulatory sequences…
Q: The pancreas is an organ of mixed secretion. Endocrinely, beta-cells produce the hormone insulin,…
A: Pancreas has 3 types of cells: α cells secrete glucagon β cells secrete insulin δ cells secrete…
Q: Make 2 mL of 50 fold dilution of DNA solution and sodium phosphate buffer. DNA: 400 uL Sodium…
A: Dilution is the process of lowering the concentration of a solution by adding more of solvent to it.…
Q: Explain the growing public health threats of emerging zoonotic infections and challenges in…
A: Zoonoses are diseases and infections that are naturally transmitted between humans and vertebrate…
Q: How many mL of 19 mM SDS would you need to make 76 mL of 2 mM SDS? Report your answer rounded to 1…
A: Molarity is a way of representing the concentration of a solution. Molarity is the number of moles…
Q: 5. Consider the fatty acid. Which of the designations are accurate for the fatty acid? -O O A) (0-6…
A: Fatty acids are the monomer units for the lipid biomolecules. Fatty acids are classified into…
Q: Would increasing the concentration of glucose be a physiologically reasonable way to increase the…
A: Glycolysis is the 10-step enzymatic conversion of one molecule of glucose to two molecules of…
Q: How many ADP molecules are phosphorylated as electrons of cytosolic NADH enter the mitochondria via…
A: Most textbooks mention that under aerobic conditions, NAD+ is regenerated in the ETC. But the…
Q: Does the complete oxidation of tridecanoic acid (C13:0) make more ATP than the complete oxidation of…
A: Triacylglycerols are stored form of lipids in the body. When there is a lack of energy and…
Q: Consider a protein with two surface-exposed histidine residues: HisA is a “typical” histidine…
A: The Henderson-Hasselbalch Equation for the deprotonation of a species is given below. pH= pKa +…
Q: “The binding of oxygen to hemoglobin exhibits positive cooperativity.” Explain briefly
A: Our red blood cells (RBCs) are composed of hemoglobin that helps to transport oxygen throughout the…
Q: The specific activity of a pure preparation of pyruvate kinase (PK) assayed in the direction of…
A: Pyruvate kinase (PK): The role of pyruvate kinase is to catalyze the final phase of glycolysis,…
Q: Please check all the proteins that would likely have a nuclear localization sequence: Histones TATA…
A: The nuclear localisation sequence(NLS) is the amino acid sequence that marks a protein for import…
Q: For each pair of biomolecules, identify the type of reaction (oxidation‑reduction, hydrolysis,…
A: Glucose and fructose are monosaccharides. Glucose is an aldose sugar and fructose is a ketose sugar.…
Q: Like other enzymes, arachidonic acid can be prevented from working by way of inhibitors. What…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: The following carbohydrate is classified as a(n): CH2OHCHOHCHOHCHOHCHOHCHO O ketohexose O…
A: Monosaccharides are the simplest carbohydrates. They are classified into two based on the functional…
Q: Muscle glycogen phosphorylase, an enzyme that provides glucose to the muscle for energy production,…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Which reaction or reactions of glycolysis require NAD* as a reactant? Which reaction or reactions in…
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: A patient on dapsone begin to experience dizziness and vertigo 3 days after taking his medication.…
A: Cyanotic defects: Cyanosis is a condition caused by cyanotic defects, in which the blood pumped to…
Q: Remaining Time: 07 minutes, 13 seconds. * Question Completion Status: closes a potassium channel…
A: Active transport is the transport of substances across the plasma membrane against their…
Q: Using the results of linear regression analysis (log(MW, kDa) vs Rr) from the protein standards,…
A: Given that the linear regression analysis data of a plot of Log MW (in kDa) vs Rf is given as:…
Q: 3. With a deficiency of thiamine - vitamin B1, beriberi disease (polyneuritis) occurs and…
A: Carbohydrates consumed in diet enter the glycolytic pathway as glucose. Pyruvate is the end product…
Q: Kinesin movement is dependent on GTP hydrolysis. True False
A: Kinesin is a motor protein that is essential for the cellular functions like mitosis, transport of…
Q: 1. Define a polynucleotide. 2. What are the types of polynucleotides? 3. Enumerate and classify all…
A: Nucleotides are the complex compounds made up of nitrogen base, a sugar residuw and a phosphate…
Q: Several problems not applicable to synthetic drugs often influence the quality of herbal drugs -…
A: Synthetic drugs are the pure form of a compound prepared and approved by testing in several trials.…
Q: Biological waxes are all: A) trimesters of glycerol and three long chain saturated fatty acids. B)…
A: Introduction: Lipids are hydrophobic molecules that are composed of carbon, oxygen, and hydrogen.…
Q: Label the parts of the below lipid molecule. Is this a saturated or unsaturated lipid? H H I-U-I H…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: At pH 10, what is the net charge of the peptide Asn-His-Glu-Cys-Ser-Lys?
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Why does glutamate the only amino acid used in oxidative deamination
A: Glutamate is an acidic amino acid that acts as the only amino acid used in oxidative deamination.…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG GUsing the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A G
- 5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13Given the genetic code below, enter the correct amino acid sequence for the following RNA sequence: AUG GAG UCC UUG CUG UGA (enter the amino acids as the 3 letter abbreviation on the table separated by dashes with no spaces e.g. Met-Thr-Lys-Glu-Ser) Alanine (Ala) AGUC Tyrosine (Tyr) Valine (Val) GU Cysteine (Cys) START HERE G Arginine (Arg) G Tryptophan (Trp) A C CUGA Serine (Ser) Leucine (Leu) Lysine (Lys) Proline (Pro) Asparagine (Asn) 0406 ACUGACUOROE (na) auone (aug) Giycine (Gly) Serine (Ser) Phenylalanine Glutamic acid (Glu) Aspartic acid (Asp) Histidine (His) Glutamine (Gin) Arginine (Arg) Isoleucine (lle) Methionine (Met) o Threonine (Thr)Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…
- Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.The DNA in the coding strand below contains a short imaginary sequence for a short protein in Squibillus notables (imaginary bacterial organism). Indicate the mRNA and amino acid sequences. Label the 5' and 3' ends, the amino (N-terminus) and carboxyl (C-terminus) ends and start/stop codons, if present, as appropriate. 5'- ATGTACCTCGACGATCAAGGCAA -3'Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′
- Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –GUACUAAGGAGGUUGUAUGGGUUAGGGG ACAUCAUUUUGA–3′Refer to the information on the genetic code. Use this information to determine how many amino acids are coded for by the mRNA sequence AUGCGCAGUCGGUAG. The genetic code Second letter of codon UAU UAC JUU Phenylalanine uCU UUC Phe) UUA Leucine (Leu) UUG Tyrosine (Tyr) GCysteine (Cys) UGC 1oStop codon |UGG Tryptophan (Trp) CGU CGC UcC Serine (Ser) UCA ucc CCU cC Proline (Pro) Stop codon UAG Stop codon CAU Histidine His) CU CUC CUA CUG Arginine (Arg) Leucine (Leu) cca CAA CCA CGA Glutamine (Gin) CAG AUU AUC AUA ACU Isoleucine (le) AAU AAC AGU AGC Asparagine (Asn) Serine (Ser) ACC Threonine (Thr) ACA Methicnine ACC start codon GCU Lysine (Lys) AGA Arginine (Arg) ARC AGS GAU Aspartic acid (Asp)G0 GAC GUU GUC Valine (Val) GCC Alanine (Ab) GG Glycine (Gly GUA GUG GCA GCG GA Glutamic acid (Glu) GA GGG GAG 4 15 First letter of codon Third letter of codon