Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 16, Problem 17RQ
An unprocessed pre-mRNA has the following structure.
Which of the following is not a possible size (in bp) of the mature mRNA?
- 205bp
- 180bp
- 150bp
- 100bp
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table for reference.
5' AGUCCGUAC 3'
5' AAUUGCUUC 3'
Assume the following portion of an mRNA. Find a start signal, and
write the amino acid sequence that is coded for.
5'-GCCAUGUUUCCGAGUUAUCCCAAAGAUAAAAAAGAG 3'
draw mRNA sequence for the following sequence
ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAG
Chapter 16 Solutions
Biology 2e
Ch. 16 - Figure 16.5 In E. coli, the tip operon is on by...Ch. 16 - Figure 16.7 In females, one of the two X...Ch. 16 - Figure 16.13 An increase in phosphorylation levels...Ch. 16 - Control of gene expression in eukaryotic cells...Ch. 16 - Post-translational control refers to: regulation...Ch. 16 - How does the regulation of gene expression support...Ch. 16 - If glucose is absent, but so is lactose, the lac...Ch. 16 - Prokaryotic cells lack a nucleus. Therefore, the...Ch. 16 - The a/a operon is an inducible operon that...Ch. 16 - What are epigenetic modifications? the addition of...
Ch. 16 - Which of the following are true of epigenetic...Ch. 16 - The binding of _____ is required for transcription...Ch. 16 - What will result from the binding of a...Ch. 16 - A scientist compares the promoter regions of two...Ch. 16 - Which of the following are involved in post...Ch. 16 - Binding of an RNA binding protein will the...Ch. 16 - An unprocessed pre-mRNA has the following...Ch. 16 - IS. Alternative splicing has been estimated to...Ch. 16 - Post-translational modifications of proteins can...Ch. 16 - A scientist mutates elF-2 to eliminate its GTP...Ch. 16 - Cancer causing genes are called transformation...Ch. 16 - Targeted therapies are used in patients with a set...Ch. 16 - Name two differences between prokaryotic and...Ch. 16 - Describe how controlling gene expression will...Ch. 16 - Describe how transcription in prokaryotic cells...Ch. 16 - What is the difference between a repressible and...Ch. 16 - In cancer cells, alteration to epigenetic...Ch. 16 - A scientific study demonstrated that rat mothering...Ch. 16 - Some autoimmune diseases show a positive...Ch. 16 - A mutation within the promoter region can alter...Ch. 16 - What could happen if a cell had too much of an...Ch. 16 - A scientist identifies a potential transcription...Ch. 16 - Describe how RBPs can prevent miRNAs from...Ch. 16 - How can external stimuli alter...Ch. 16 - Protein modification can alter gene expression in...Ch. 16 - Alternative forms of a protein can be beneficial...Ch. 16 - Changes in epigenetic modifications alter the...Ch. 16 - A scientist discovers a virus encoding a Protein X...Ch. 16 - New drugs are being developed that decrease DNA...Ch. 16 - How can understanding the gene expression pattern...
Additional Science Textbook Solutions
Find more solutions based on key concepts
At its peak, a tornado is 60.0 m in diameter and carries 500 km/h winds. What is its angular velocity in revolu...
College Physics
Level 2: Application/Analysis 4. Nitrifying bactcria participatc in the nitrogen cycle mainly by (A) converting...
Campbell Biology (11th Edition)
Raw Oysters and Antacids: A Deadly Mix? The highly acidic environment of the stomach kills most bacteria before...
Microbiology with Diseases by Body System (4th Edition)
2. Define equilibrium population. Outline the conditions that must be met for a population to stay in genetic e...
Biology: Life on Earth
Which one of Mendel's laws describes the inheritance of alleles for a Single character? Which law relates to th...
Campbell Biology (10th Edition)
CAUTION How can evolutionary fitness be estimated? a. Document how long individuals survive. b. Count the numbe...
Biological Science (6th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Compare bacterial and eukaryotic mRNAs, and explain the functional significance of their structural differences.arrow_forwardUsing the genetic code table provided below, write out the sequence of three different possible mRNA sequences that could encode the following sequence of amino acids: Met-Phe-Cys-Trp-Glu C A G U C UUU Phe UCU Ser UUC Phe UCC Ser UCA Ser UUA Leu UUG Leu UCG Ser CUU Leu CCU Pro CUC Leu CUA Leu CUG Leu CCG A CAU His CGU Arg CCC Pro CAC His CGC Arg UAU Tyr UGU Cys U UAC Tyr UGC Cys C Stop UGA Stop Stop UGG Trp UAA A UAG G CCA Pro CAA Gln Pro CAG AUU lle AUC lle AUA lle AUG Met ACG G 등등 Gln CGA Arg CGG Arg ACU Thr AAU Asn AGU Ser ACC AAC Asn AGC Ser Thr ACA Thr Thr AAA Lys AGA Arg AAG Lys AGG Arg GUU Val GCU Ala GAU Asp GGU Gly GGC Gly GUC Val GCC Ala GAC Asp GUA Val GCA Ala GAA Glu GGA Gly GUG Val GCG Ala GAG Glu GGG Gly U C A G U C A G SUAUarrow_forwardIdentify the different regions of the mature mRNA by matching terms with regions. regions are shown in the second image terms: poly-A-tail 5'UTR 3'UTR coding sequencearrow_forward
- A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)arrow_forwardFor the following mRNA sequence (reading from left to right) what will be the amino acid sequence following translation? (Use chart provided) AUGCCAGUUGAAUAA First position U C A UUU UUC UUA UUG CUU CUC CUA CUG U >Phe GUU GUC GUA GUG >Leu >Leu AUU ACU AUC lle ACC AUA ACA AUG Met/start ACG >Val UCU UCC UCA UCG ©2019 Pearson Education, Inc. CCU CCC CCA CCG GCU GCC GCA GCG Second position A >Ser >Pro Thr >Ala UAU UGU U UAC UGC C UAA Stop UGA Stop A UAG Stop UGG Trp G CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG Tyr >His >Gin >Asn >Lys >Asp >Glu CGU CGC CGA CGG AGU AGC AGA AGG G GGU GGC GGA GGG >Cys Arg >Ser >Arg >Gly DOAG SCAG U с А UCA с А G Third position Correct answer not given Met-Val-Tyr-Pro Met-His-Phe-Ala-Arg Pro-Val-Met-Leu-His Met-Pro-Val-Gluarrow_forwardAn mRNA transcript is listed below and contains both start and termination codons. Assume that the initial methionine will stay on the polypeptide in this case. What amino acid sequence will be specified during translation? List the amino acids. The start codon is highlighted. 5’ – CAGCCAAGCAUGCUCGCAAAUGGACGUUGAUAUUUUGUC – 3’arrow_forward
- Using the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A Garrow_forwardThe eukaryotic cell is different from the prokaryotic cell. Outline the structural difference between these two types of cell and suggest two reasons why eukaryotic mRNA needs to be modified before translation.arrow_forwardAssuming that it is exactly and only 5 nucleotides long, write the Shine-Dalgarno sequence in the MRNA sequence below: UAACUAAGGAUGUAGUUAUGarrow_forward
- Given the following mRNA transcript: 5’-UUUGGCAUGGGUAUCGUAGAGAUGGAAUUCAUAGUGGAGUAA-3’ What is the one-letter abbreviation of the protein product of the mRNA transcript?arrow_forwardWhich of the followings indicate the order of procaryotic mRNA degreadation? cleavage of the triphosphate 5′ terminus to yield a monophosphate- 3′ to 5′exonuclease digestion- The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme cleavage of the triphosphate 5′ terminus to yield a monophosphate- The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme- 3′ to 5′exonuclease digestion The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme- cleavage of the triphosphate 5′ terminus to yield a monophosphate- 3′ to 5′exonuclease digestionarrow_forwardWhat will be the overall anti-codon sequence in tRNA for this mRNA? 5’-GUAGCCUUAUCUAGCGAUCACCGUCCGUAUUACUAGUGGCCAGACUCUUUUCACCAUGUAUAGUUG-3’arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY