The reason that a recA protein mutation in Escherichia coli make it a better host for the propagation of recombinant plasmid DNA (Deoxyribose nucleic acid ). Introduction: Restriction endonucleases which are also called molecular scissors are the enzymes that are used in molecular biology for the formation of the recombinant molecule. Plasmid vectors act as the carriers of foreign information that has to be incorporated into a recombinant molecule.

Question

Want to see the full answer?

Answer 1

Question

Chapter 25, Problem 25.11PS

(a)

Summary Introduction

To determine: The reason that a recA protein mutation in Escherichia coli make it a better host for the propagation of recombinant plasmid DNA (Deoxyribose nucleic acid).

Introduction: Restriction endonucleases which are also called molecular scissors are the enzymes that are used in molecular biology for the formation of the recombinant molecule. Plasmid vectors act as the carriers of foreign information that has to be incorporated into a recombinant molecule.

(b)

Summary Introduction

To determine: The reason that mutations in restriction endonucleases of Escherichia coli are useful.

Introduction: Restriction endonucleases which are also called molecular scissors are the enzymes that are used in molecular biology for the formation of the recombinant molecule. Plasmid vectors act as the carriers of foreign information that has to be incorporated into a recombinant molecule.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Please answer this asap. Thanks, You have discovered a new plasmid RK21 in a unique bacterial community. As a first step towardunderstanding this plasmid, you digest the plasmid with three restriction enzymes: SspI, XhoI andSmaI. You run the digested plasmid DNA on an agarose gel, along with an uncut sample of theRK21 plasmid DNA as a control.Unfortunately you forget to load a DNA ladder, and obtain the following results. Assumecomplete digestion of all samples or all the digests worked completely

please help me with this question. As this is a non-directional cloning, recombinant plasmids can contain an insert ligated into the vector in two different orientations. Provide two diagrams to illustrate the two potential recombinant plasmids, with the inserts ligated in opposite orientations. Include all RE sites and distances between sites on the diagram.

Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are shown below (lower case shaded blue). 1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this a plasmid with the same restriction sites. gene into GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…